Rmu_sc0004553.1_g000005

60S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004553.1
Physical Location & Seq
Forward (+)
14300 .. 15552
1253 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004553.1_g000005.1.cds

Sequence Viewer

Length: 402 bp
atgcctttcaagaggtacgtggagatcggaagggtggctctcgtcaactacggcgaggactacggcaagctcgtcgtcatcgtcgacgtcatcgaccagaacagagctcttgttgatgcccctgatatggtgagatctcaaatgaatttcaagaggctttctctcactgacatcaaaattgacatcaagagggtccccaagaagaaggaattgcttgccgcaatggaggctgctgatgttaagaagaagtgggaaagtagctcttggggtaggaagcttattgttcagaagcgaagggccaatcttaatgactttgatcgcttcaagcttatgttggccaagatcaagagggctggcctggtcaagagcgaacttgcaaaactgaagaagcagagtgcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

133

Amino Acids

15.33

Weight (kDa)

10.18

Isoelectric Point (pI)

32.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 90
AccI GTMKAC 1 cut(s) 84
AciI CCGC 1 cut(s) 219
AcoI YGGCCR 1 cut(s) 336
AcsI RAATTY 1 cut(s) 145
AcyI GRCGYC 1 cut(s) 87
AfaI GTAC 1 cut(s) 17
AfiI CCNNNNNNNGG 1 cut(s) 127
AgsI TTSAA 3 cut(s) 10, 151, 325
AjnI CCWGG 1 cut(s) 357
AluBI AGCT 5 cut(s) 70, 107, 261, 277, 328
AluI AGCT 5 cut(s) 70, 107, 261, 277, 328
Alw21I GWGCWC 1 cut(s) 109
AoxI GGCC 3 cut(s) 297, 336, 355
ApeKI GCWGC 1 cut(s) 230
ApoI RAATTY 1 cut(s) 145
AspS9I GGNCC 2 cut(s) 193, 297
AsuHPI GGTGA 1 cut(s) 142
AvaII GGWCC 1 cut(s) 193
BalI TGGCCA 1 cut(s) 338
BanII GRGCYC 1 cut(s) 109
Bbv12I GWGCWC 1 cut(s) 109
BbvI GCAGC 1 cut(s) 217
BceAI ACGGC 2 cut(s) 67, 79
BcgI CGANNNNNNTGC 2 cut(s) 55, 89
BciT130I CCWGG 1 cut(s) 359
BglII AGATCT 1 cut(s) 134
BisI GCNGC 2 cut(s) 219, 231
BlsI GCNGC 2 cut(s) 220, 232
Bme1390I CCNGG 1 cut(s) 359
Bme18I GGWCC 1 cut(s) 193
BmgT120I GGNCC 2 cut(s) 193, 297
BmiI GGNNCC 2 cut(s) 194, 195
BmrFI CCNGG 1 cut(s) 359
BmsI GCATC 1 cut(s) 106
BplI GAGNNNNNCTC 2 cut(s) 145, 177
BsaAI YACGTR 1 cut(s) 19
BsaHI GRCGYC 1 cut(s) 87
Bsc4I CCNNNNNNNGG 1 cut(s) 127
Bse3DI GCAATG 1 cut(s) 228
BseBI CCWGG 1 cut(s) 359
BseLI CCNNNNNNNGG 1 cut(s) 127
BseMI GCAATG 1 cut(s) 228
BseXI GCAGC 1 cut(s) 217
BshFI GGCC 3 cut(s) 299, 338, 357
BsiHKAI GWGCWC 1 cut(s) 109
BslFI GGGAC 1 cut(s) 179
BslI CCNNNNNNNGG 1 cut(s) 127
BsmFI GGGAC 1 cut(s) 179
BsnI GGCC 3 cut(s) 299, 338, 357
Bsp1286I GDGCHC 1 cut(s) 109
Bsp143I GATC 4 cut(s) 24, 134, 316, 342
BspACI CCGC 1 cut(s) 219
BspANI GGCC 3 cut(s) 299, 338, 357
BspLI GGNNCC 2 cut(s) 194, 195
BsrDI GCAATG 1 cut(s) 228
BssMI GATC 4 cut(s) 24, 134, 316, 342
BssNI GRCGYC 1 cut(s) 87
Bst2UI CCWGG 1 cut(s) 359
BstACI GRCGYC 1 cut(s) 87
BstBAI YACGTR 1 cut(s) 19
BstC8I GCNNGC 3 cut(s) 68, 216, 355
BstDEI CTNAG 1 cut(s) 399
BstKTI GATC 4 cut(s) 27, 137, 319, 345
BstMBI GATC 4 cut(s) 24, 134, 316, 342
BstMWI GCNNNNNNNGC 1 cut(s) 227
BstNI CCWGG 1 cut(s) 359
BstSCI CCNGG 1 cut(s) 357
BstV1I GCAGC 1 cut(s) 217
BstX2I RGATCY 1 cut(s) 134
BstYI RGATCY 1 cut(s) 134
BsuRI GGCC 3 cut(s) 299, 338, 357
BtsIMutI CAGTG 1 cut(s) 165
Cac8I GCNNGC 3 cut(s) 68, 216, 355
Cfr13I GGNCC 2 cut(s) 193, 297
Csp6I GTAC 1 cut(s) 16
CviQI GTAC 1 cut(s) 16
DdeI CTNAG 1 cut(s) 399
DpnI GATC 4 cut(s) 26, 136, 318, 344
DpnII GATC 4 cut(s) 24, 134, 316, 342
EaeI YGGCCR 1 cut(s) 336
Ecl136II GAGCTC 1 cut(s) 107
Eco24I GRGCYC 1 cut(s) 109
Eco47I GGWCC 1 cut(s) 193
Eco53kI GAGCTC 1 cut(s) 107
EcoICRI GAGCTC 1 cut(s) 107
EcoO109I RGGNCCY 1 cut(s) 193
EcoRII CCWGG 1 cut(s) 357
EcoT38I GRGCYC 1 cut(s) 109
FaiI YATR 2 cut(s) 128, 332
FalI AAGNNNNNCTT 2 cut(s) 247, 279
FaqI GGGAC 1 cut(s) 179
FblI GTMKAC 1 cut(s) 84
Fnu4HI GCNGC 2 cut(s) 219, 231
FriOI GRGCYC 1 cut(s) 109
Fsp4HI GCNGC 2 cut(s) 219, 231
GluI GCNGC 2 cut(s) 219, 231
HaeIII GGCC 3 cut(s) 299, 338, 357
Hin1I GRCGYC 1 cut(s) 87
HincII GTYRAC 2 cut(s) 46, 85
HindII GTYRAC 2 cut(s) 46, 85
HindIII AAGCTT 2 cut(s) 275, 326
HphI GGTGA 1 cut(s) 142
Hpy166II GTNNAC 2 cut(s) 46, 85
Hpy188I TCNGA 2 cut(s) 29, 288
Hpy188III TCNNGA 5 cut(s) 10, 151, 187, 346, 364
Hpy8I GTNNAC 2 cut(s) 46, 85
Hpy99I CGWCG 3 cut(s) 77, 86, 89
HpyAV CCTTC 3 cut(s) 24, 199, 288
HpyCH4IV ACGT 2 cut(s) 18, 87
HpyCH4V TGCA 1 cut(s) 377
HpyF10VI GCNNNNNNNGC 1 cut(s) 227
HpyF3I CTNAG 1 cut(s) 399
HpySE526I ACGT 2 cut(s) 18, 87
Hsp92I GRCGYC 1 cut(s) 87
KflI GGGWCCC 1 cut(s) 193
Kzo9I GATC 4 cut(s) 24, 134, 316, 342
LpnPI CCDG 5 cut(s) 110, 135, 339, 344, 371
Lsp1109I GCAGC 1 cut(s) 217
LweI GCATC 1 cut(s) 106
MaeII ACGT 2 cut(s) 18, 87
MalI GATC 4 cut(s) 26, 136, 318, 344
MboI GATC 4 cut(s) 24, 134, 316, 342
MboII GAAGA 3 cut(s) 214, 256, 397
MflI RGATCY 1 cut(s) 134
MhlI GDGCHC 1 cut(s) 109
MlsI TGGCCA 1 cut(s) 338
MluCI AATT 3 cut(s) 145, 177, 209
MluNI TGGCCA 1 cut(s) 338
MnlI CCTC 6 cut(s) 6, 49, 147, 183, 220, 342
Mox20I TGGCCA 1 cut(s) 338
MscI TGGCCA 1 cut(s) 338
MseI TTAA 2 cut(s) 240, 306
Msp20I TGGCCA 1 cut(s) 338
MspR9I CCNGG 1 cut(s) 359
MvaI CCWGG 1 cut(s) 359
MwoI GCNNNNNNNGC 1 cut(s) 227
NdeII GATC 4 cut(s) 24, 134, 316, 342
NlaIV GGNNCC 2 cut(s) 194, 195
PcsI WCGNNNNNNNCGW 4 cut(s) 69, 78, 81, 90
PkrI GCNGC 2 cut(s) 220, 232
Ppu21I YACGTR 1 cut(s) 19
PpuMI RGGWCCY 1 cut(s) 193
Psp124BI GAGCTC 1 cut(s) 109
Psp5II RGGWCCY 1 cut(s) 193
Psp6I CCWGG 1 cut(s) 357
PspGI CCWGG 1 cut(s) 357
PspN4I GGNNCC 2 cut(s) 194, 195
PspPI GGNCC 2 cut(s) 193, 297
PspPPI RGGWCCY 1 cut(s) 193
PsuI RGATCY 1 cut(s) 134
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
SacI GAGCTC 1 cut(s) 109
SalI GTCGAC 1 cut(s) 83
SaqAI TTAA 2 cut(s) 240, 306
SatI GCNGC 2 cut(s) 219, 231
Sau3AI GATC 4 cut(s) 24, 134, 316, 342
Sau96I GGNCC 2 cut(s) 193, 297
ScrFI CCNGG 1 cut(s) 359
SduI GDGCHC 1 cut(s) 109
SetI ASST 8 cut(s) 17, 21, 72, 90, 109, 263, 279, 330
SfaNI GCATC 1 cut(s) 106
SgrDI CGTCGACG 1 cut(s) 83
SinI GGWCC 1 cut(s) 193
Sse9I AATT 3 cut(s) 145, 177, 209
SsiI CCGC 1 cut(s) 219
SstI GAGCTC 1 cut(s) 109
StyD4I CCNGG 1 cut(s) 357
TaiI ACGT 2 cut(s) 21, 90
TaqI TCGA 2 cut(s) 84, 93
TasI AATT 3 cut(s) 145, 177, 209
TauI GCSGC 1 cut(s) 221
Tru1I TTAA 2 cut(s) 240, 306
Tru9I TTAA 2 cut(s) 240, 306
TscAI CASTG 1 cut(s) 172
TseI GCWGC 1 cut(s) 230
TspDTI ATGAA 1 cut(s) 158
TspRI CASTG 1 cut(s) 172
VpaK11BI GGWCC 1 cut(s) 193
XapI RAATTY 1 cut(s) 145
XmiI GTMKAC 1 cut(s) 84
ZraI GACGTC 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.