Rmu_sc0004555.1_g000004

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004555.1
Physical Location & Seq
Reverse (-)
18105 .. 18509
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004555.1_g000004.1.cds

Sequence Viewer

Length: 219 bp
atgagcatggaaatcgagaagattgatagaaaaaggcgagatcgtcttaggtcggccattggccagactagcagacaaggtgacgatggcaataagctattgtggctggacagggtgaccggaagggtttgcacgtcgatttctgcaaaggccatggctataacagggattgaggatcggcgatactggaactggattgctactgaagaatcaaggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.4

Weight (kDa)

9.84

Isoelectric Point (pI)

80.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 183
AcoI YGGCCR 2 cut(s) 54, 61
AjiI CACGTC 1 cut(s) 135
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
AlwI GGATC 1 cut(s) 183
AoxI GGCC 3 cut(s) 54, 61, 150
AsuHPI GGTGA 2 cut(s) 92, 127
BalI TGGCCA 1 cut(s) 63
BccI CCATC 1 cut(s) 80
BcgI CGANNNNNNTGC 1 cut(s) 29
BfaI CTAG 1 cut(s) 69
BmgBI CACGTC 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 153
BsaWI WCCGGW 1 cut(s) 119
Bse1I ACTGG 2 cut(s) 191, 197
BseDI CCNNGG 1 cut(s) 153
BseNI ACTGG 2 cut(s) 191, 197
BshFI GGCC 3 cut(s) 56, 63, 152
BsiSI CCGG 1 cut(s) 120
BsnI GGCC 3 cut(s) 56, 63, 152
Bsp143I GATC 2 cut(s) 40, 175
Bsp19I CCATGG 1 cut(s) 153
BspANI GGCC 3 cut(s) 56, 63, 152
BspPI GGATC 1 cut(s) 183
BsrI ACTGG 2 cut(s) 191, 197
BssECI CCNNGG 1 cut(s) 153
BssMI GATC 2 cut(s) 40, 175
BssT1I CCWWGG 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 47
BstDSI CCRYGG 1 cut(s) 153
BstEII GGTNACC 1 cut(s) 115
BstKTI GATC 2 cut(s) 43, 178
BstMBI GATC 2 cut(s) 40, 175
BstMWI GCNNNNNNNGC 2 cut(s) 69, 103
BstPI GGTNACC 1 cut(s) 115
BsuRI GGCC 3 cut(s) 56, 63, 152
BtgI CCRYGG 1 cut(s) 153
BtrI CACGTC 1 cut(s) 135
CviAII CATG 2 cut(s) 7, 154
CviJI RGCY 6 cut(s) 56, 63, 97, 106, 152, 158
CviKI_1 RGCY 6 cut(s) 56, 63, 97, 106, 152, 158
DdeI CTNAG 1 cut(s) 47
DpnI GATC 2 cut(s) 42, 177
DpnII GATC 2 cut(s) 40, 175
EaeI YGGCCR 2 cut(s) 54, 61
Eco130I CCWWGG 1 cut(s) 153
Eco91I GGTNACC 1 cut(s) 115
EcoO65I GGTNACC 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 153
ErhI CCWWGG 1 cut(s) 153
FaeI CATG 2 cut(s) 10, 157
FaiI YATR 3 cut(s) 8, 155, 161
FatI CATG 2 cut(s) 6, 153
FspBI CTAG 1 cut(s) 69
HaeIII GGCC 3 cut(s) 56, 63, 152
HapII CCGG 1 cut(s) 120
Hin1II CATG 2 cut(s) 10, 157
HinfI GANTC 1 cut(s) 209
HpaII CCGG 1 cut(s) 120
HphI GGTGA 2 cut(s) 92, 127
Hpy188III TCNNGA 1 cut(s) 16
Hpy99I CGWCG 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 117
HpyCH4IV ACGT 1 cut(s) 134
HpyCH4V TGCA 2 cut(s) 132, 146
HpyF10VI GCNNNNNNNGC 2 cut(s) 69, 103
HpyF3I CTNAG 1 cut(s) 47
HpySE526I ACGT 1 cut(s) 134
Hsp92II CATG 2 cut(s) 10, 157
Kzo9I GATC 2 cut(s) 40, 175
LpnPI CCDG 7 cut(s) 77, 92, 97, 133, 150, 172, 178
MaeI CTAG 1 cut(s) 69
MaeII ACGT 1 cut(s) 134
MaeIII GTNAC 2 cut(s) 80, 115
MalI GATC 2 cut(s) 42, 177
MboI GATC 2 cut(s) 40, 175
MboII GAAGA 2 cut(s) 31, 218
MlsI TGGCCA 1 cut(s) 63
MluNI TGGCCA 1 cut(s) 63
MnlI CCTC 1 cut(s) 166
Mox20I TGGCCA 1 cut(s) 63
MscI TGGCCA 1 cut(s) 63
Msp20I TGGCCA 1 cut(s) 63
MspI CCGG 1 cut(s) 120
MwoI GCNNNNNNNGC 2 cut(s) 69, 103
NcoI CCATGG 1 cut(s) 153
NdeII GATC 2 cut(s) 40, 175
NlaIII CATG 2 cut(s) 10, 157
NmuCI GTSAC 2 cut(s) 80, 115
PfeI GAWTC 1 cut(s) 209
PspEI GGTNACC 1 cut(s) 115
Sau3AI GATC 2 cut(s) 40, 175
SetI ASST 5 cut(s) 53, 82, 99, 137, 218
SspMI CTAG 1 cut(s) 69
StyI CCWWGG 1 cut(s) 153
TaiI ACGT 1 cut(s) 137
TaqI TCGA 2 cut(s) 15, 137
TfiI GAWTC 1 cut(s) 209
TseFI GTSAC 2 cut(s) 80, 115
Tsp45I GTSAC 2 cut(s) 80, 115
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.