Rroxscaffold_4G00280140

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
2782014 .. 2782399
386 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00280140.1

Sequence Viewer

Length: 219 bp
ATGAGCATGGAAATCGAGAAGATTGATAGAAAAAGGCGAGATCGTCTAGGGTCGGCCATCGGAAGAACTAGCAGGCAAGGTGACGATGGCAATAAGGTAGGGGCTCTTGAATTAGGGTTTTGGGTTGTGGCTGGACAGGGTGACCGGAAGGCCATGGCTATAACAGGGATTGAGGATCGGCGATACTGGAACTGGATTGCTACTGAAGAATCAAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.21

Weight (kDa)

9.39

Isoelectric Point (pI)

61.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 183
AcoI YGGCCR 1 cut(s) 54
AgsI TTSAA 1 cut(s) 110
AlwI GGATC 1 cut(s) 183
AoxI GGCC 2 cut(s) 54, 150
AsuHPI GGTGA 2 cut(s) 92, 152
BanII GRGCYC 1 cut(s) 106
BccI CCATC 2 cut(s) 65, 80
BcgI CGANNNNNNTGC 1 cut(s) 29
BfaI CTAG 2 cut(s) 47, 69
BsaJI CCNNGG 1 cut(s) 153
BsaWI WCCGGW 1 cut(s) 144
Bse1I ACTGG 2 cut(s) 191, 197
BseDI CCNNGG 1 cut(s) 153
BseNI ACTGG 2 cut(s) 191, 197
BshFI GGCC 2 cut(s) 56, 152
BsiSI CCGG 1 cut(s) 145
BsnI GGCC 2 cut(s) 56, 152
Bsp1286I GDGCHC 1 cut(s) 106
Bsp143I GATC 2 cut(s) 40, 175
Bsp19I CCATGG 1 cut(s) 153
BspANI GGCC 2 cut(s) 56, 152
BspPI GGATC 1 cut(s) 183
BsrI ACTGG 2 cut(s) 191, 197
BssECI CCNNGG 1 cut(s) 153
BssMI GATC 2 cut(s) 40, 175
BssT1I CCWWGG 1 cut(s) 153
BstC8I GCNNGC 1 cut(s) 74
BstDSI CCRYGG 1 cut(s) 153
BstEII GGTNACC 1 cut(s) 140
BstKTI GATC 2 cut(s) 43, 178
BstMBI GATC 2 cut(s) 40, 175
BstPI GGTNACC 1 cut(s) 140
BsuRI GGCC 2 cut(s) 56, 152
BtgI CCRYGG 1 cut(s) 153
Cac8I GCNNGC 1 cut(s) 74
CviAII CATG 2 cut(s) 7, 154
CviJI RGCY 5 cut(s) 56, 104, 131, 152, 158
CviKI_1 RGCY 5 cut(s) 56, 104, 131, 152, 158
DpnI GATC 2 cut(s) 42, 177
DpnII GATC 2 cut(s) 40, 175
EaeI YGGCCR 1 cut(s) 54
Eco130I CCWWGG 1 cut(s) 153
Eco24I GRGCYC 1 cut(s) 106
Eco91I GGTNACC 1 cut(s) 140
EcoO65I GGTNACC 1 cut(s) 140
EcoT14I CCWWGG 1 cut(s) 153
EcoT38I GRGCYC 1 cut(s) 106
ErhI CCWWGG 1 cut(s) 153
FaeI CATG 2 cut(s) 10, 157
FaiI YATR 3 cut(s) 8, 155, 161
FatI CATG 2 cut(s) 6, 153
FriOI GRGCYC 1 cut(s) 106
FspBI CTAG 2 cut(s) 47, 69
HaeIII GGCC 2 cut(s) 56, 152
HapII CCGG 1 cut(s) 145
Hin1II CATG 2 cut(s) 10, 157
HinfI GANTC 1 cut(s) 209
HpaII CCGG 1 cut(s) 145
HphI GGTGA 2 cut(s) 92, 152
Hpy188I TCNGA 1 cut(s) 62
Hpy188III TCNNGA 2 cut(s) 16, 107
HpyAV CCTTC 1 cut(s) 142
Hsp92II CATG 2 cut(s) 10, 157
Kzo9I GATC 2 cut(s) 40, 175
LpnPI CCDG 7 cut(s) 58, 117, 122, 150, 158, 172, 178
MaeI CTAG 2 cut(s) 47, 69
MaeIII GTNAC 2 cut(s) 80, 140
MalI GATC 2 cut(s) 42, 177
MboI GATC 2 cut(s) 40, 175
MboII GAAGA 3 cut(s) 31, 75, 218
MhlI GDGCHC 1 cut(s) 106
MluCI AATT 1 cut(s) 110
MnlI CCTC 1 cut(s) 166
MspI CCGG 1 cut(s) 145
NcoI CCATGG 1 cut(s) 153
NdeII GATC 2 cut(s) 40, 175
NlaIII CATG 2 cut(s) 10, 157
NmuCI GTSAC 2 cut(s) 80, 140
PfeI GAWTC 1 cut(s) 209
PspEI GGTNACC 1 cut(s) 140
Sau3AI GATC 2 cut(s) 40, 175
SduI GDGCHC 1 cut(s) 106
SetI ASST 3 cut(s) 82, 99, 218
Sse9I AATT 1 cut(s) 110
SspMI CTAG 2 cut(s) 47, 69
StyI CCWWGG 1 cut(s) 153
TaqI TCGA 1 cut(s) 15
TasI AATT 1 cut(s) 110
TfiI GAWTC 1 cut(s) 209
TseFI GTSAC 2 cut(s) 80, 140
Tsp45I GTSAC 2 cut(s) 80, 140
XspI CTAG 2 cut(s) 47, 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.