Rh4BG169500

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0008544
Physical Location & Seq
Reverse (-)
30380051 .. 30385429
5379 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG169500.1

Sequence Viewer

Length: 252 bp
ATGCGAAATAAGACGAGCAGGCAAGGTGACGATGGCAATAAGCTATTGTGGCTGGACAGGGTGACCGGAAGGGTTTGCACGTCGATTTCTGCGAAGGCCATGGCTATAACAGGGATTGAGGATCGGCGATACTGGAACTGGATTGCTACTGAAGAATCAAGCCTATCAGCATTTTCGTCATGGCTAAAGTTTTCTCTTAGCCGTGAGTATAGTCTAGAACTTCAGAAACAATTTGTGTCCACAATCGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005488 GO:0030246
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PP2

Protein Analysis

83

Amino Acids

9.6

Weight (kDa)

8.93

Isoelectric Point (pI)

62.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2 PF14299 25 - 57 1.5e-06 Phloem protein 2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 129
AcuI CTGAAG 2 cut(s) 171, 206
AjiI CACGTC 1 cut(s) 81
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
AlwI GGATC 1 cut(s) 129
AoxI GGCC 1 cut(s) 96
AsuHPI GGTGA 2 cut(s) 38, 73
BccI CCATC 1 cut(s) 26
BceAI ACGGC 1 cut(s) 186
BfaI CTAG 1 cut(s) 215
BmgBI CACGTC 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 99
BsaWI WCCGGW 1 cut(s) 65
Bse1I ACTGG 2 cut(s) 137, 143
BseDI CCNNGG 1 cut(s) 99
BseNI ACTGG 2 cut(s) 137, 143
BshFI GGCC 1 cut(s) 98
BsiSI CCGG 1 cut(s) 66
BsnI GGCC 1 cut(s) 98
Bsp143I GATC 1 cut(s) 121
Bsp19I CCATGG 1 cut(s) 99
BspANI GGCC 1 cut(s) 98
BspPI GGATC 1 cut(s) 129
BsrI ACTGG 2 cut(s) 137, 143
BssECI CCNNGG 1 cut(s) 99
BssMI GATC 1 cut(s) 121
BssT1I CCWWGG 1 cut(s) 99
BstC8I GCNNGC 1 cut(s) 20
BstDEI CTNAG 1 cut(s) 197
BstDSI CCRYGG 1 cut(s) 99
BstEII GGTNACC 1 cut(s) 61
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstMWI GCNNNNNNNGC 1 cut(s) 49
BstPI GGTNACC 1 cut(s) 61
BsuRI GGCC 1 cut(s) 98
BtgI CCRYGG 1 cut(s) 99
BtrI CACGTC 1 cut(s) 81
Cac8I GCNNGC 1 cut(s) 20
CviAII CATG 2 cut(s) 100, 180
CviJI RGCY 7 cut(s) 43, 52, 98, 104, 162, 184, 201
CviKI_1 RGCY 7 cut(s) 43, 52, 98, 104, 162, 184, 201
DdeI CTNAG 1 cut(s) 197
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
Eco130I CCWWGG 1 cut(s) 99
Eco57I CTGAAG 2 cut(s) 171, 206
Eco91I GGTNACC 1 cut(s) 61
EcoO65I GGTNACC 1 cut(s) 61
EcoT14I CCWWGG 1 cut(s) 99
ErhI CCWWGG 1 cut(s) 99
FaeI CATG 2 cut(s) 103, 183
FaiI YATR 4 cut(s) 101, 107, 181, 210
FatI CATG 2 cut(s) 99, 179
FspBI CTAG 1 cut(s) 215
HaeIII GGCC 1 cut(s) 98
HapII CCGG 1 cut(s) 66
Hin1II CATG 2 cut(s) 103, 183
HinfI GANTC 1 cut(s) 155
HpaII CCGG 1 cut(s) 66
HphI GGTGA 2 cut(s) 38, 73
Hpy166II GTNNAC 1 cut(s) 240
Hpy188I TCNGA 1 cut(s) 225
Hpy188III TCNNGA 1 cut(s) 215
Hpy8I GTNNAC 1 cut(s) 240
Hpy99I CGWCG 1 cut(s) 85
HpyAV CCTTC 2 cut(s) 63, 88
HpyCH4IV ACGT 1 cut(s) 80
HpyCH4V TGCA 1 cut(s) 78
HpyF10VI GCNNNNNNNGC 1 cut(s) 49
HpyF3I CTNAG 1 cut(s) 197
HpySE526I ACGT 1 cut(s) 80
Hsp92II CATG 2 cut(s) 103, 183
Kzo9I GATC 1 cut(s) 121
LpnPI CCDG 7 cut(s) 4, 38, 43, 79, 96, 118, 124
MaeI CTAG 1 cut(s) 215
MaeII ACGT 1 cut(s) 80
MaeIII GTNAC 2 cut(s) 26, 61
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MboII GAAGA 1 cut(s) 164
MluCI AATT 1 cut(s) 230
MnlI CCTC 1 cut(s) 112
MspI CCGG 1 cut(s) 66
MwoI GCNNNNNNNGC 1 cut(s) 49
NcoI CCATGG 1 cut(s) 99
NdeII GATC 1 cut(s) 121
NlaIII CATG 2 cut(s) 103, 183
NmuCI GTSAC 2 cut(s) 26, 61
PcsI WCGNNNNNNNCGW 1 cut(s) 89
PfeI GAWTC 1 cut(s) 155
PspEI GGTNACC 1 cut(s) 61
Sau3AI GATC 1 cut(s) 121
SetI ASST 3 cut(s) 28, 45, 83
Sse9I AATT 1 cut(s) 230
SspMI CTAG 1 cut(s) 215
StyI CCWWGG 1 cut(s) 99
TaiI ACGT 1 cut(s) 83
TaqI TCGA 2 cut(s) 83, 246
TasI AATT 1 cut(s) 230
TfiI GAWTC 1 cut(s) 155
TseFI GTSAC 2 cut(s) 26, 61
Tsp45I GTSAC 2 cut(s) 26, 61
XbaI TCTAGA 1 cut(s) 214
XspI CTAG 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.