Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004908.1

Orthogroup ID

OG0009649

Physical Location & Seq

Genomic Coordinates Forward (+)

120641 .. 120961

Gene Structure 321 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004908.1_g000021.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 321 bp

atgacctcctcaaccttcgagtggctctgcaccttgctcgagcccttactcgagtgcagggacccgattggcttcccgctcaatctctcccccgacctcggccttggaatccgcatgttccgcctggccaccggagccaattacctggagatatcaagacaattccgggtttcggagtctgtgtcgagattttgctccaagcaattgtgtcgtgttgttctctgcactaactaccgattctggattgagtttctgaataagactgagcttgaatcggtgtcttcgaaacccacaccgggttgcccaattgttgcggtgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DDE_Tnp_4

Protein Analysis

106

Amino Acids

12.04

Weight (kDa)

7.55

Isoelectric Point (pI)

48.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009649)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g05781
malus_domestica	MD05G1083600.v1.1
prunus_persica	Prupe.8G128000_v2.0.a1
pyrus_communis	pycom10g08050
rosa_chinensis	RchiOBHm_Chr6g0256701
rosa_laevigata	RLG00000014740 RLG00000025774
rosa_multiflora	Rmu_sc0004908.1_g000021 Rmu_sc0010161.1_g000023
rosa_roxburghii	Rroxscaffold_7G00209110 Rroxscaffold_7G00209120
rosa_rugosa	Rorug05G0565800
rosa_samantha	Rh4CG107600 Rh6AG083800 Rh6BG078300 Rh6CG072900 Rh6DG070100 Rh7AG174500 Rh7BG177700 Rh7CG183700 Rh7DG177100
rosa_wichuraiana	Rw6G007530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	79
AciI	CCGC	4 cut(s)	77, 112, 121, 314
AcoI	YGGCCR	1 cut(s)	126
AfiI	CCNNNNNNNGG	4 cut(s)	21, 98, 172, 296
AgsI	TTSAA	1 cut(s)	272
AjnI	CCWGG	2 cut(s)	123, 144
AluBI	AGCT	1 cut(s)	268
AluI	AGCT	1 cut(s)	268
Ama87I	CYCGRG	2 cut(s)	38, 50
AoxI	GGCC	2 cut(s)	100, 126
AspS9I	GGNCC	1 cut(s)	61
AsuC2I	CCSGG	2 cut(s)	167, 297
AsuII	TTCGAA	1 cut(s)	284
AvaI	CYCGRG	2 cut(s)	38, 50
AvaII	GGWCC	1 cut(s)	61
BalI	TGGCCA	1 cut(s)	128
BanII	GRGCYC	1 cut(s)	45
BbsI	GAAGAC	1 cut(s)	273
BcgI	CGANNNNNNTGC	4 cut(s)	19, 53, 191, 225
BciT130I	CCWGG	2 cut(s)	125, 146
BcnI	CCSGG	2 cut(s)	167, 297
Bme1390I	CCNGG	4 cut(s)	125, 146, 167, 297
Bme18I	GGWCC	1 cut(s)	61
BmeT110I	CYCGRG	2 cut(s)	38, 50
BmgT120I	GGNCC	1 cut(s)	61
BmiI	GGNNCC	3 cut(s)	62, 63, 136
BmrFI	CCNGG	4 cut(s)	125, 146, 167, 297
BpiI	GAAGAC	1 cut(s)	273
BpmI	CTGGAG	1 cut(s)	167
Bpu14I	TTCGAA	1 cut(s)	284
BpuMI	CCSGG	2 cut(s)	167, 297
BsaJI	CCNNGG	2 cut(s)	97, 103
BsaWI	WCCGGW	1 cut(s)	131
BsaXI	ACNNNNNCTCC	2 cut(s)	167, 197
Bsc4I	CCNNNNNNNGG	4 cut(s)	21, 98, 172, 296
BseBI	CCWGG	2 cut(s)	125, 146
BseDI	CCNNGG	2 cut(s)	97, 103
BseLI	CCNNNNNNNGG	4 cut(s)	21, 98, 172, 296
BseMII	CTCAG	1 cut(s)	255
BsgI	GTGCAG	3 cut(s)	13, 76, 208
BshFI	GGCC	2 cut(s)	102, 128
BsiHKCI	CYCGRG	2 cut(s)	38, 50
BsiSI	CCGG	3 cut(s)	132, 166, 296
BslFI	GGGAC	1 cut(s)	74
BslI	CCNNNNNNNGG	4 cut(s)	21, 98, 172, 296
BsmFI	GGGAC	1 cut(s)	74
BsnI	GGCC	2 cut(s)	102, 128
BsoBI	CYCGRG	2 cut(s)	38, 50
Bsp119I	TTCGAA	1 cut(s)	284
Bsp1286I	GDGCHC	1 cut(s)	45
BspACI	CCGC	4 cut(s)	77, 112, 121, 314
BspANI	GGCC	2 cut(s)	102, 128
BspCNI	CTCAG	1 cut(s)	256
BspLI	GGNNCC	3 cut(s)	62, 63, 136
BspT104I	TTCGAA	1 cut(s)	284
BsrBI	CCGCTC	1 cut(s)	79
BssECI	CCNNGG	2 cut(s)	97, 103
BssT1I	CCWWGG	1 cut(s)	103
Bst2UI	CCWGG	2 cut(s)	125, 146
BstBI	TTCGAA	1 cut(s)	284
BstDEI	CTNAG	1 cut(s)	264
BstMWI	GCNNNNNNNGC	2 cut(s)	120, 134
BstNI	CCWGG	2 cut(s)	125, 146
BstNSI	RCATGY	1 cut(s)	118
BstSCI	CCNGG	4 cut(s)	123, 144, 165, 295
BstV2I	GAAGAC	1 cut(s)	273
BstXI	CCANNNNNNTGG	1 cut(s)	145
BsuRI	GGCC	2 cut(s)	102, 128
Cfr13I	GGNCC	1 cut(s)	61
CviAII	CATG	1 cut(s)	115
CviJI	RGCY	7 cut(s)	25, 43, 72, 102, 128, 137, 268
CviKI_1	RGCY	7 cut(s)	25, 43, 72, 102, 128, 137, 268
DdeI	CTNAG	1 cut(s)	264
EaeI	YGGCCR	1 cut(s)	126
EciI	GGCGGA	1 cut(s)	110
Eco130I	CCWWGG	1 cut(s)	103
Eco24I	GRGCYC	1 cut(s)	45
Eco32I	GATATC	1 cut(s)	153
Eco47I	GGWCC	1 cut(s)	61
Eco88I	CYCGRG	2 cut(s)	38, 50
EcoO109I	RGGNCCY	1 cut(s)	61
EcoRII	CCWGG	2 cut(s)	123, 144
EcoRV	GATATC	1 cut(s)	153
EcoT14I	CCWWGG	1 cut(s)	103
EcoT38I	GRGCYC	1 cut(s)	45
ErhI	CCWWGG	1 cut(s)	103
FaeI	CATG	1 cut(s)	118
FaiI	YATR	1 cut(s)	116
FaqI	GGGAC	1 cut(s)	74
FatI	CATG	1 cut(s)	114
FauI	CCCGC	1 cut(s)	84
FriOI	GRGCYC	1 cut(s)	45
GsuI	CTGGAG	1 cut(s)	167
HaeIII	GGCC	2 cut(s)	102, 128
HapII	CCGG	3 cut(s)	132, 166, 296
Hin1II	CATG	1 cut(s)	118
HinfI	GANTC	4 cut(s)	108, 176, 237, 272
HpaII	CCGG	3 cut(s)	132, 166, 296
Hpy188I	TCNGA	2 cut(s)	175, 255
Hpy188III	TCNNGA	3 cut(s)	156, 186, 241
HpyAV	CCTTC	1 cut(s)	25
HpyCH4V	TGCA	3 cut(s)	30, 57, 225
HpyF10VI	GCNNNNNNNGC	2 cut(s)	120, 134
HpyF3I	CTNAG	1 cut(s)	264
Hsp92II	CATG	1 cut(s)	118
KflI	GGGWCCC	1 cut(s)	61
LmnI	GCTCC	2 cut(s)	134, 200
LpnPI	CCDG	9 cut(s)	43, 110, 131, 137, 145, 158, 179, 226, 309
MbiI	CCGCTC	1 cut(s)	79
MboII	GAAGA	1 cut(s)	273
MfeI	CAATTG	2 cut(s)	203, 306
MhlI	GDGCHC	1 cut(s)	45
MlsI	TGGCCA	1 cut(s)	128
MluCI	AATT	4 cut(s)	139, 161, 203, 306
MluNI	TGGCCA	1 cut(s)	128
MlyI	GAGTC	1 cut(s)	185
MnlI	CCTC	3 cut(s)	16, 19, 107
Mox20I	TGGCCA	1 cut(s)	128
MscI	TGGCCA	1 cut(s)	128
Msp20I	TGGCCA	1 cut(s)	128
MspI	CCGG	3 cut(s)	132, 166, 296
MspR9I	CCNGG	4 cut(s)	125, 146, 167, 297
MunI	CAATTG	2 cut(s)	203, 306
MvaI	CCWGG	2 cut(s)	125, 146
MwoI	GCNNNNNNNGC	2 cut(s)	120, 134
NciI	CCSGG	2 cut(s)	167, 297
NlaIII	CATG	1 cut(s)	118
NlaIV	GGNNCC	3 cut(s)	62, 63, 136
NmeAIII	GCCGAG	1 cut(s)	78
NspI	RCATGY	1 cut(s)	118
NspV	TTCGAA	1 cut(s)	284
PaeR7I	CTCGAG	2 cut(s)	38, 50
PcsI	WCGNNNNNNNCGW	1 cut(s)	281
PfeI	GAWTC	3 cut(s)	108, 237, 272
PleI	GAGTC	1 cut(s)	184
PpsI	GAGTC	1 cut(s)	184
PpuMI	RGGWCCY	1 cut(s)	61
Psp5II	RGGWCCY	1 cut(s)	61
Psp6I	CCWGG	2 cut(s)	123, 144
PspGI	CCWGG	2 cut(s)	123, 144
PspN4I	GGNNCC	3 cut(s)	62, 63, 136
PspPI	GGNCC	1 cut(s)	61
PspPPI	RGGWCCY	1 cut(s)	61
PspXI	VCTCGAGB	2 cut(s)	38, 50
Sau96I	GGNCC	1 cut(s)	61
SchI	GAGTC	1 cut(s)	185
ScrFI	CCNGG	4 cut(s)	125, 146, 167, 297
SduI	GDGCHC	1 cut(s)	45
SetI	ASST	6 cut(s)	8, 17, 35, 99, 147, 270
Sfr274I	CTCGAG	2 cut(s)	38, 50
SfuI	TTCGAA	1 cut(s)	284
SinI	GGWCC	1 cut(s)	61
SlaI	CTCGAG	2 cut(s)	38, 50
SmlI	CTYRAG	2 cut(s)	38, 50
SmoI	CTYRAG	2 cut(s)	38, 50
Sse9I	AATT	4 cut(s)	139, 161, 203, 306
SsiI	CCGC	4 cut(s)	77, 112, 121, 314
StyD4I	CCNGG	4 cut(s)	123, 144, 165, 295
StyI	CCWWGG	1 cut(s)	103
TaqI	TCGA	5 cut(s)	18, 39, 51, 185, 284
TasI	AATT	4 cut(s)	139, 161, 203, 306
TfiI	GAWTC	3 cut(s)	108, 237, 272
VpaK11BI	GGWCC	1 cut(s)	61
XceI	RCATGY	1 cut(s)	118
XhoI	CTCGAG	2 cut(s)	38, 50

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.