Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4C

Orthogroup ID

OG0009649

Physical Location & Seq

Genomic Coordinates Forward (+)

20115316 .. 20115504

Gene Structure 189 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4CG107600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGACCTCCTCAACCTTCGAGTGGCTCTGCTCCTTGCTCGAGCCCTTACTCGAGTGCAGGGACCCGATTGGCTCCCCGCTCAATCTCTCCACAGACCTCAGCCTTGGAATAGACCTATTCCACTTGGCCACTGGAGCCAGTTACCCGGAGATATCAAGACAATTCCGGGTTTCGGAGTCTGTGTCGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DDE_Tnp_4

Protein Analysis

62

Amino Acids

6.83

Weight (kDa)

4.33

Isoelectric Point (pI)

46.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009649)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g05781
malus_domestica	MD05G1083600.v1.1
prunus_persica	Prupe.8G128000_v2.0.a1
pyrus_communis	pycom10g08050
rosa_chinensis	RchiOBHm_Chr6g0256701
rosa_laevigata	RLG00000014740 RLG00000025774
rosa_multiflora	Rmu_sc0004908.1_g000021 Rmu_sc0010161.1_g000023
rosa_roxburghii	Rroxscaffold_7G00209110 Rroxscaffold_7G00209120
rosa_rugosa	Rorug05G0565800
rosa_samantha	Rh4CG107600 Rh6AG083800 Rh6BG078300 Rh6CG072900 Rh6DG070100 Rh7AG174500 Rh7BG177700 Rh7CG183700 Rh7DG177100
rosa_wichuraiana	Rw6G007530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	79
AciI	CCGC	1 cut(s)	77
AcoI	YGGCCR	1 cut(s)	126
AfiI	CCNNNNNNNGG	2 cut(s)	21, 172
Ama87I	CYCGRG	2 cut(s)	38, 50
AoxI	GGCC	1 cut(s)	126
AspS9I	GGNCC	1 cut(s)	61
AsuC2I	CCSGG	2 cut(s)	146, 167
AvaI	CYCGRG	2 cut(s)	38, 50
AvaII	GGWCC	1 cut(s)	61
BalI	TGGCCA	1 cut(s)	128
BanII	GRGCYC	1 cut(s)	45
BbvCI	CCTCAGC	1 cut(s)	98
BcnI	CCSGG	2 cut(s)	146, 167
Bme1390I	CCNGG	2 cut(s)	146, 167
Bme18I	GGWCC	1 cut(s)	61
BmeT110I	CYCGRG	2 cut(s)	38, 50
BmgT120I	GGNCC	1 cut(s)	61
BmiI	GGNNCC	4 cut(s)	62, 63, 73, 136
BmrFI	CCNGG	2 cut(s)	146, 167
BpmI	CTGGAG	1 cut(s)	153
Bpu10I	CCTNAGC	1 cut(s)	98
BpuMI	CCSGG	2 cut(s)	146, 167
BsaJI	CCNNGG	1 cut(s)	103
BsaXI	ACNNNNNCTCC	1 cut(s)	167
Bsc4I	CCNNNNNNNGG	2 cut(s)	21, 172
Bse1I	ACTGG	2 cut(s)	136, 138
BseDI	CCNNGG	1 cut(s)	103
BseLI	CCNNNNNNNGG	2 cut(s)	21, 172
BseMII	CTCAG	1 cut(s)	112
BseNI	ACTGG	2 cut(s)	136, 138
BsgI	GTGCAG	1 cut(s)	76
BshFI	GGCC	1 cut(s)	128
BsiHKCI	CYCGRG	2 cut(s)	38, 50
BsiSI	CCGG	2 cut(s)	146, 166
BslFI	GGGAC	1 cut(s)	74
BslI	CCNNNNNNNGG	2 cut(s)	21, 172
BsmFI	GGGAC	1 cut(s)	74
BsnI	GGCC	1 cut(s)	128
BsoBI	CYCGRG	2 cut(s)	38, 50
Bsp1286I	GDGCHC	1 cut(s)	45
BspACI	CCGC	1 cut(s)	77
BspANI	GGCC	1 cut(s)	128
BspCNI	CTCAG	1 cut(s)	111
BspLI	GGNNCC	4 cut(s)	62, 63, 73, 136
BsrBI	CCGCTC	1 cut(s)	79
BsrI	ACTGG	2 cut(s)	136, 138
BssECI	CCNNGG	1 cut(s)	103
BssT1I	CCWWGG	1 cut(s)	103
BstDEI	CTNAG	1 cut(s)	98
BstMWI	GCNNNNNNNGC	1 cut(s)	134
BstSCI	CCNGG	2 cut(s)	144, 165
BsuRI	GGCC	1 cut(s)	128
BtsIMutI	CAGTG	1 cut(s)	129
Cfr13I	GGNCC	1 cut(s)	61
CviJI	RGCY	6 cut(s)	25, 43, 72, 102, 128, 137
CviKI_1	RGCY	6 cut(s)	25, 43, 72, 102, 128, 137
DdeI	CTNAG	1 cut(s)	98
EaeI	YGGCCR	1 cut(s)	126
Eco130I	CCWWGG	1 cut(s)	103
Eco24I	GRGCYC	1 cut(s)	45
Eco32I	GATATC	1 cut(s)	153
Eco47I	GGWCC	1 cut(s)	61
Eco88I	CYCGRG	2 cut(s)	38, 50
EcoO109I	RGGNCCY	1 cut(s)	61
EcoRV	GATATC	1 cut(s)	153
EcoT14I	CCWWGG	1 cut(s)	103
EcoT38I	GRGCYC	1 cut(s)	45
ErhI	CCWWGG	1 cut(s)	103
FaqI	GGGAC	1 cut(s)	74
FauI	CCCGC	1 cut(s)	84
FriOI	GRGCYC	1 cut(s)	45
GsuI	CTGGAG	1 cut(s)	153
HaeIII	GGCC	1 cut(s)	128
HapII	CCGG	2 cut(s)	146, 166
HinfI	GANTC	1 cut(s)	176
HpaII	CCGG	2 cut(s)	146, 166
Hpy188I	TCNGA	1 cut(s)	175
Hpy188III	TCNNGA	2 cut(s)	156, 186
HpyAV	CCTTC	1 cut(s)	25
HpyCH4V	TGCA	1 cut(s)	57
HpyF10VI	GCNNNNNNNGC	1 cut(s)	134
HpyF3I	CTNAG	1 cut(s)	98
KflI	GGGWCCC	1 cut(s)	61
LmnI	GCTCC	3 cut(s)	35, 77, 134
LpnPI	CCDG	5 cut(s)	43, 117, 151, 159, 179
MaeIII	GTNAC	1 cut(s)	140
MbiI	CCGCTC	1 cut(s)	79
MhlI	GDGCHC	1 cut(s)	45
MlsI	TGGCCA	1 cut(s)	128
MluCI	AATT	1 cut(s)	161
MluNI	TGGCCA	1 cut(s)	128
MlyI	GAGTC	1 cut(s)	185
MnlI	CCTC	3 cut(s)	16, 19, 107
Mox20I	TGGCCA	1 cut(s)	128
MscI	TGGCCA	1 cut(s)	128
Msp20I	TGGCCA	1 cut(s)	128
MspI	CCGG	2 cut(s)	146, 166
MspR9I	CCNGG	2 cut(s)	146, 167
MwoI	GCNNNNNNNGC	1 cut(s)	134
NciI	CCSGG	2 cut(s)	146, 167
NlaIV	GGNNCC	4 cut(s)	62, 63, 73, 136
PaeR7I	CTCGAG	2 cut(s)	38, 50
PleI	GAGTC	1 cut(s)	184
PpsI	GAGTC	1 cut(s)	184
PpuMI	RGGWCCY	1 cut(s)	61
Psp5II	RGGWCCY	1 cut(s)	61
PspN4I	GGNNCC	4 cut(s)	62, 63, 73, 136
PspPI	GGNCC	1 cut(s)	61
PspPPI	RGGWCCY	1 cut(s)	61
PspXI	VCTCGAGB	2 cut(s)	38, 50
Sau96I	GGNCC	1 cut(s)	61
SchI	GAGTC	1 cut(s)	185
ScrFI	CCNGG	2 cut(s)	146, 167
SduI	GDGCHC	1 cut(s)	45
SetI	ASST	4 cut(s)	8, 17, 99, 117
Sfr274I	CTCGAG	2 cut(s)	38, 50
SinI	GGWCC	1 cut(s)	61
SlaI	CTCGAG	2 cut(s)	38, 50
SmlI	CTYRAG	2 cut(s)	38, 50
SmoI	CTYRAG	2 cut(s)	38, 50
Sse9I	AATT	1 cut(s)	161
SsiI	CCGC	1 cut(s)	77
StyD4I	CCNGG	2 cut(s)	144, 165
StyI	CCWWGG	1 cut(s)	103
TaqI	TCGA	3 cut(s)	18, 39, 51
TasI	AATT	1 cut(s)	161
TscAI	CASTG	1 cut(s)	136
TspRI	CASTG	1 cut(s)	136
VpaK11BI	GGWCC	1 cut(s)	61
XcmI	CCANNNNNNNNNTGG	1 cut(s)	128
XhoI	CTCGAG	2 cut(s)	38, 50

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.