Rroxscaffold_7G00209120
ERF Family

DDE superfamily endonuclease

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
59374675 .. 59376432
1758 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00209120.1

Sequence Viewer

Length: 348 bp
ATGAAGATGGCTGTTGCTTATATTGGTGCTTGTTCTATACTACATAATGGTTTGTTGATGAGGGAGGACTATTCGGCAATGTCTGCTGGGTTGGATGATTACTCTGTCTATGATCAGAGCTCTCAGTATCATAGGGATAATTCAAGTTTGGAGGAGAGTTCAATTGAGAGGAAGGCTTCTGTTATAAGAAATGCATTGGCTACAAAAGCAAAAGAGTTTCAAGAATCAATATTTTCGACACATTCTAGCTCGTTGGCACAGGGCAACAACTCGCATGCCTCTAAAAAGTTGAAAGGCATGCCCCTTTCTTGCAAGCCTCCCAAACTCCAATTCAACGAGCTTCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

12.75

Weight (kDa)

8.57

Isoelectric Point (pI)

60.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 185
AgsI TTSAA 5 cut(s) 144, 162, 221, 292, 334
AjuI GAANNNNNNNTTGG 2 cut(s) 314, 346
AluBI AGCT 3 cut(s) 120, 249, 340
AluI AGCT 3 cut(s) 120, 249, 340
Alw21I GWGCWC 1 cut(s) 122
BanII GRGCYC 1 cut(s) 122
Bbv12I GWGCWC 1 cut(s) 122
BclI TGATCA 1 cut(s) 112
BfaI CTAG 1 cut(s) 246
Bse3DI GCAATG 1 cut(s) 84
BseGI GGATG 1 cut(s) 100
BseMI GCAATG 1 cut(s) 84
BseMII CTCAG 1 cut(s) 137
BseRI GAGGAG 1 cut(s) 167
BseYI CCCAGC 1 cut(s) 86
BsiHKAI GWGCWC 1 cut(s) 122
Bsp1286I GDGCHC 1 cut(s) 122
Bsp143I GATC 1 cut(s) 112
BspCNI CTCAG 1 cut(s) 136
BsrDI GCAATG 1 cut(s) 84
BssMI GATC 1 cut(s) 112
BstAPI GCANNNNNTGC 1 cut(s) 83
BstC8I GCNNGC 3 cut(s) 276, 299, 314
BstDEI CTNAG 1 cut(s) 123
BstF5I GGATG 1 cut(s) 100
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstMWI GCNNNNNNNGC 2 cut(s) 83, 206
BstNSI RCATGY 2 cut(s) 278, 301
BtsCI GGATG 1 cut(s) 100
Cac8I GCNNGC 3 cut(s) 276, 299, 314
CviAII CATG 2 cut(s) 275, 298
CviJI RGCY 7 cut(s) 11, 120, 176, 200, 249, 316, 340
CviKI_1 RGCY 7 cut(s) 11, 120, 176, 200, 249, 316, 340
DdeI CTNAG 1 cut(s) 123
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Ecl136II GAGCTC 1 cut(s) 120
Eco24I GRGCYC 1 cut(s) 122
Eco53kI GAGCTC 1 cut(s) 120
EcoICRI GAGCTC 1 cut(s) 120
EcoT22I ATGCAT 1 cut(s) 196
EcoT38I GRGCYC 1 cut(s) 122
FaeI CATG 2 cut(s) 278, 301
FaiI YATR 8 cut(s) 21, 38, 45, 111, 132, 185, 276, 299
FatI CATG 2 cut(s) 274, 297
FbaI TGATCA 1 cut(s) 112
FokI GGATG 1 cut(s) 107
FriOI GRGCYC 1 cut(s) 122
FspBI CTAG 1 cut(s) 246
GsaI CCCAGC 1 cut(s) 90
Hin1II CATG 2 cut(s) 278, 301
HinfI GANTC 1 cut(s) 224
Hpy188I TCNGA 1 cut(s) 117
Hpy188III TCNNGA 1 cut(s) 221
HpyAV CCTTC 1 cut(s) 166
HpyCH4V TGCA 2 cut(s) 194, 312
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 206
HpyF3I CTNAG 1 cut(s) 123
Hsp92II CATG 2 cut(s) 278, 301
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 2 cut(s) 72, 245
MaeI CTAG 1 cut(s) 246
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 1 cut(s) 16
MfeI CAATTG 1 cut(s) 162
MhlI GDGCHC 1 cut(s) 122
MluCI AATT 3 cut(s) 139, 162, 329
MmeI TCCRAC 1 cut(s) 72
MnlI CCTC 6 cut(s) 54, 58, 145, 162, 289, 327
Mph1103I ATGCAT 1 cut(s) 196
MunI CAATTG 1 cut(s) 162
MwoI GCNNNNNNNGC 2 cut(s) 83, 206
NdeII GATC 1 cut(s) 112
NlaIII CATG 2 cut(s) 278, 301
NsiI ATGCAT 1 cut(s) 196
NspI RCATGY 2 cut(s) 278, 301
PaeI GCATGC 2 cut(s) 278, 301
PfeI GAWTC 1 cut(s) 224
PsiI TTATAA 1 cut(s) 185
Psp124BI GAGCTC 1 cut(s) 122
PspFI CCCAGC 1 cut(s) 86
SacI GAGCTC 1 cut(s) 122
Sau3AI GATC 1 cut(s) 112
SduI GDGCHC 1 cut(s) 122
SetI ASST 3 cut(s) 122, 251, 342
SphI GCATGC 2 cut(s) 278, 301
Sse9I AATT 3 cut(s) 139, 162, 329
SspI AATATT 1 cut(s) 231
SspMI CTAG 1 cut(s) 246
SstI GAGCTC 1 cut(s) 122
TaqI TCGA 1 cut(s) 236
TasI AATT 3 cut(s) 139, 162, 329
TfiI GAWTC 1 cut(s) 224
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 2 cut(s) 278, 301
XspI CTAG 1 cut(s) 246
Zsp2I ATGCAT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.