Rmu_sc0005018.1_g000005

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005018.1
Physical Location & Seq
Reverse (-)
35596 .. 38067
2472 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005018.1_g000005.1.cds

Sequence Viewer

Length: 399 bp
atggagagtaatttgcaagacaactttgaggaactgacggctaagggcgcccaagccactccggacgtcgataggagctggttggtgaggtttgtcttgcatctgttggtgagcgttgttcaaaatgtatctgagaaggtgtcggagcgagctaagagggccttacgatcggttctcccagttgcaatccccaccgagttggtggggttttatgttgatggggttctaatgctggcgtttttgtggatgttgaaggcatatcttgaggtcatttgcactcttggtagcctagtctttgtaagcatcttactcattcatggtatctggattggagtggcttatgtacaagaaaactgcaaccataaaggcggcaatgttgaagatgaaggccgccgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

132

Amino Acids

14.76

Weight (kDa)

5.57

Isoelectric Point (pI)

46.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 69
AccB1I GGYRCC 1 cut(s) 47
AccIII TCCGGA 1 cut(s) 61
AciI CCGC 2 cut(s) 369, 391
AcyI GRCGYC 2 cut(s) 48, 66
AfaI GTAC 1 cut(s) 345
AgsI TTSAA 3 cut(s) 122, 253, 380
AluBI AGCT 2 cut(s) 78, 152
AluI AGCT 2 cut(s) 78, 152
Aor13HI TCCGGA 1 cut(s) 61
AoxI GGCC 2 cut(s) 159, 388
AspLEI GCGC 1 cut(s) 50
AspS9I GGNCC 1 cut(s) 159
AsuHPI GGTGA 2 cut(s) 97, 121
BanI GGYRCC 1 cut(s) 47
BccI CCATC 1 cut(s) 212
BceAI ACGGC 2 cut(s) 54, 378
BfaI CTAG 1 cut(s) 290
BfoI RGCGCY 1 cut(s) 51
BisI GCNGC 2 cut(s) 370, 391
BlsI GCNGC 2 cut(s) 371, 392
BmgT120I GGNCC 1 cut(s) 159
BmiI GGNNCC 1 cut(s) 49
BmrI ACTGGG 1 cut(s) 173
BmsI GCATC 2 cut(s) 109, 312
BmuI ACTGGG 1 cut(s) 173
Bpu10I CCTNAGC 1 cut(s) 42
BpuEI CTTGAG 1 cut(s) 284
BsaHI GRCGYC 2 cut(s) 48, 66
BsaWI WCCGGW 1 cut(s) 61
Bse1I ACTGG 1 cut(s) 179
Bse3DI GCAATG 1 cut(s) 379
BseAI TCCGGA 1 cut(s) 61
BseGI GGATG 1 cut(s) 252
BseMI GCAATG 1 cut(s) 379
BseMII CTCAG 1 cut(s) 123
BseNI ACTGG 1 cut(s) 179
Bsh1285I CGRYCG 1 cut(s) 170
BshFI GGCC 2 cut(s) 161, 390
BshNI GGYRCC 1 cut(s) 47
BsiEI CGRYCG 1 cut(s) 170
BsiSI CCGG 1 cut(s) 62
BsnI GGCC 2 cut(s) 161, 390
Bsp13I TCCGGA 1 cut(s) 61
Bsp1407I TGTACA 1 cut(s) 343
Bsp143I GATC 1 cut(s) 167
BspACI CCGC 2 cut(s) 369, 391
BspANI GGCC 2 cut(s) 161, 390
BspCNI CTCAG 1 cut(s) 124
BspEI TCCGGA 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 49
BspT107I GGYRCC 1 cut(s) 47
BsrDI GCAATG 1 cut(s) 379
BsrGI TGTACA 1 cut(s) 343
BsrI ACTGG 1 cut(s) 179
BssMI GATC 1 cut(s) 167
BssNI GRCGYC 2 cut(s) 48, 66
BstACI GRCGYC 2 cut(s) 48, 66
BstAUI TGTACA 1 cut(s) 343
BstC8I GCNNGC 2 cut(s) 150, 234
BstDEI CTNAG 3 cut(s) 42, 132, 153
BstF5I GGATG 1 cut(s) 252
BstH2I RGCGCY 1 cut(s) 51
BstHHI GCGC 1 cut(s) 50
BstKTI GATC 1 cut(s) 170
BstMBI GATC 1 cut(s) 167
BstMCI CGRYCG 1 cut(s) 170
BstMWI GCNNNNNNNGC 2 cut(s) 47, 158
BstXI CCANNNNNNTGG 1 cut(s) 199
BsuRI GGCC 2 cut(s) 161, 390
BtsCI GGATG 1 cut(s) 252
Cac8I GCNNGC 2 cut(s) 150, 234
CfoI GCGC 1 cut(s) 50
Cfr13I GGNCC 1 cut(s) 159
Csp6I GTAC 1 cut(s) 344
CviAII CATG 1 cut(s) 317
CviJI RGCY 8 cut(s) 41, 56, 78, 152, 161, 288, 338, 390
CviKI_1 RGCY 8 cut(s) 41, 56, 78, 152, 161, 288, 338, 390
CviQI GTAC 1 cut(s) 344
DdeI CTNAG 3 cut(s) 42, 132, 153
DinI GGCGCC 1 cut(s) 49
DpnI GATC 1 cut(s) 169
DpnII GATC 1 cut(s) 167
EcoO109I RGGNCCY 1 cut(s) 159
EgeI GGCGCC 1 cut(s) 49
EheI GGCGCC 1 cut(s) 49
FaeI CATG 1 cut(s) 320
FaiI YATR 5 cut(s) 213, 259, 318, 342, 363
FalI AAGNNNNNCTT 2 cut(s) 146, 178
FatI CATG 1 cut(s) 316
Fnu4HI GCNGC 2 cut(s) 370, 391
FokI GGATG 1 cut(s) 259
Fsp4HI GCNGC 2 cut(s) 370, 391
FspBI CTAG 1 cut(s) 290
GlaI GCGC 1 cut(s) 49
GluI GCNGC 2 cut(s) 370, 391
HaeII RGCGCY 1 cut(s) 51
HaeIII GGCC 2 cut(s) 161, 390
HapII CCGG 1 cut(s) 62
HhaI GCGC 1 cut(s) 50
Hin1I GRCGYC 2 cut(s) 48, 66
Hin1II CATG 1 cut(s) 320
Hin6I GCGC 1 cut(s) 48
HinP1I GCGC 1 cut(s) 48
HpaII CCGG 1 cut(s) 62
HphI GGTGA 2 cut(s) 97, 121
Hpy188I TCNGA 2 cut(s) 133, 145
Hpy188III TCNNGA 3 cut(s) 62, 263, 325
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 3 cut(s) 130, 247, 380
HpyCH4IV ACGT 1 cut(s) 66
HpyCH4V TGCA 5 cut(s) 16, 100, 185, 276, 357
HpyF10VI GCNNNNNNNGC 2 cut(s) 47, 158
HpyF3I CTNAG 3 cut(s) 42, 132, 153
HpySE526I ACGT 1 cut(s) 66
Hsp92I GRCGYC 2 cut(s) 48, 66
Hsp92II CATG 1 cut(s) 320
HspAI GCGC 1 cut(s) 48
KasI GGCGCC 1 cut(s) 47
Kpn2I TCCGGA 1 cut(s) 61
Kzo9I GATC 1 cut(s) 167
LmnI GCTCC 2 cut(s) 75, 145
LpnPI CCDG 5 cut(s) 64, 75, 192, 218, 310
LweI GCATC 2 cut(s) 109, 312
MaeI CTAG 1 cut(s) 290
MaeII ACGT 1 cut(s) 66
MalI GATC 1 cut(s) 169
MboI GATC 1 cut(s) 167
MboII GAAGA 1 cut(s) 392
MluCI AATT 1 cut(s) 10
Mly113I GGCGCC 1 cut(s) 48
MmeI TCCRAC 1 cut(s) 123
MnlI CCTC 4 cut(s) 22, 81, 150, 259
MroI TCCGGA 1 cut(s) 61
MspI CCGG 1 cut(s) 62
MwoI GCNNNNNNNGC 2 cut(s) 47, 158
NarI GGCGCC 1 cut(s) 48
NdeII GATC 1 cut(s) 167
NlaIII CATG 1 cut(s) 320
NlaIV GGNNCC 1 cut(s) 49
PkrI GCNGC 2 cut(s) 371, 392
Ple19I CGATCG 1 cut(s) 170
PluTI GGCGCC 1 cut(s) 51
PspN4I GGNNCC 1 cut(s) 49
PspPI GGNCC 1 cut(s) 159
PvuI CGATCG 1 cut(s) 170
RsaI GTAC 1 cut(s) 345
RsaNI GTAC 1 cut(s) 344
SatI GCNGC 2 cut(s) 370, 391
Sau3AI GATC 1 cut(s) 167
Sau96I GGNCC 1 cut(s) 159
SetI ASST 6 cut(s) 69, 80, 92, 141, 154, 270
SfaNI GCATC 2 cut(s) 109, 312
SfoI GGCGCC 1 cut(s) 49
SmlI CTYRAG 1 cut(s) 263
SmoI CTYRAG 1 cut(s) 263
Sse9I AATT 1 cut(s) 10
SsiI CCGC 2 cut(s) 369, 391
SspDI GGCGCC 1 cut(s) 47
SspMI CTAG 1 cut(s) 290
TaiI ACGT 1 cut(s) 69
TaqI TCGA 1 cut(s) 69
TasI AATT 1 cut(s) 10
TatI WGTACW 1 cut(s) 343
TauI GCSGC 2 cut(s) 372, 393
TspDTI ATGAA 2 cut(s) 305, 399
XcmI CCANNNNNNNNNTGG 1 cut(s) 199
XspI CTAG 1 cut(s) 290
ZraI GACGTC 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.