Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005082.1

Orthogroup ID

OG0004103

Physical Location & Seq

Genomic Coordinates Forward (+)

11942 .. 14376

Gene Structure 2435 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005082.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1353 bp

atgagcaattcaagtaggactacgtcgttcagcccgactacatcattcaataggagcacatcattcaatagaagtacatcattcaaatcaagaaccccgactgtagcaagcccaaccgtcagtcaatctagctgggtgtcgcgggttactccatttagctgggtctcgcgttggtttcacacactcatagtgattttcacattcatttcgtttctcactgccgtttatgggggttatctatatgtgatgccaagtctcaacctgacttttcatggttatggtgctttggaacctgctcagtcgataagcagttgcaatatgtttgatggaagttgggttgttgatgataattacccattgtacaatgctacagagtgtccctttgtggagcaggggttcaattgtttggctaatggtcgaagagataaggattatctgaaatacaggtggaaacccaataattgtgatataccaagatttaatgtgcagagtatattggacaagcttagaggaaaaagagttgtttttgtgggggattctatgagtagaacacagtgggagtcactaatttgcttgctcatgactggggtggaggataagaagagtgtctacgaagtcaacgggaataagattaccaaacagatcagatatttgggtgctcacttcagttccttcaattttactgtcgagttctttcgatcagttttcctggttcaacagggttggatgcctagacatgttccaaagagggtcaagtctatactaaagttggacaagttagatgacattagcaatcagtggattaattcagatgttctgatattcaacacgggacagtggtgggttccaggaaaactctttgacacgggttgctatttccaggttggaaactcactaaagcttggaatgtcaattcctactgcctttagaacagcactggatacttgggcagcttgggttgaggaaaagatcgccactaacagaactcatgtcttttttcggacttttgagccctctcactggagtgatccaactcgtagattttgcaatgtgaccgatcaccccatgttagacaccagaggtagggacttaagcatattttcagacactgtacatgaggtggtcaagaatatgacagttcctgtagccgttcttcatgtgacttccatgtcatctttccgaagtgatgcacatgtcggtaactggagcgataaaccatccattcctgattgtagccactggtgtcttccaggattacctgatgtatggaatgaaatcatcctcttttacctgtttaatgacaaagggcttccttttctagagggattcgagccttggcattctggtggatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0008150 GO:0008374 GO:0009987 GO:0012505 GO:0016407 GO:0016413 GO:0016740 GO:0016746 GO:0016747 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0071554

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PC-Esterase PMR5N

Protein Analysis

450

Amino Acids

51.6

Weight (kDa)

8.76

Isoelectric Point (pI)

40.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004103)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G48880
fragaria_vesca	FvH4_1g24130 FvH4_2g14650 FvH4_2g14650 FvH4_2g14650
malus_domestica	MD05G1015200.v1.1
prunus_persica	Prupe.8G018900_v2.0.a1 Prupe.8G018900_v2.0.a1
pyrus_communis	pycom05g00830
rosa_chinensis	RchiOBHm_Chr2g0120351 RchiOBHm_Chr6g0277131
rosa_laevigata	RLG00000013329 RLG00000018550
rosa_multiflora	Rmu_sc0005082.1_g000004 Rmu_sc0005082.1_g000006 Rmu_sc0006244.1_g000042 Rmu_sc0011301.1_g000001
rosa_roxburghii	Rroxscaffold_2G00123500 Rroxscaffold_7G00191580
rosa_rugosa	Rorug02G0228600 Rorug02G0228700 Rorug02G0228800 Rorug06G0106500
rosa_samantha	Rh2AG285000 Rh2BG295900 Rh2CG273600 Rh2DG310000 Rh6AG217200 Rh6BG221200 Rh6CG224100 Rh6DG213800
rosa_wichuraiana	Rw2G022870 Rw6G018960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1168
Acc36I	ACCTGC	1 cut(s)	301
AccI	GTMKAC	1 cut(s)	609
AccII	CGCG	2 cut(s)	142, 169
AciI	CCGC	1 cut(s)	142
AclWI	GGATC	1 cut(s)	1022
AcuI	CTGAAG	1 cut(s)	649
AfaI	GTAC	3 cut(s)	76, 362, 1113
AfiI	CCNNNNNNNGG	3 cut(s)	228, 1020, 1083
AflII	CTTAAG	1 cut(s)	1090
AflIII	ACRYGT	2 cut(s)	736, 1192
AgsI	TTSAA	8 cut(s)	12, 49, 67, 85, 400, 676, 716, 826
AjnI	CCWGG	4 cut(s)	708, 847, 879, 1249
AleI	CACNNNNGTG	1 cut(s)	1023
AloI	GAACNNNNNNTCC	2 cut(s)	380, 412
AluBI	AGCT	5 cut(s)	132, 159, 505, 901, 953
AluI	AGCT	5 cut(s)	132, 159, 505, 901, 953
Alw21I	GWGCWC	2 cut(s)	59, 661
Alw26I	GTCTC	2 cut(s)	169, 260
AlwI	GGATC	1 cut(s)	1022
AlwNI	CAGNNNCTG	2 cut(s)	1109, 1142
ApeKI	GCWGC	1 cut(s)	950
AseI	ATTAAT	1 cut(s)	804
AsuHPI	GGTGA	1 cut(s)	1052
BanII	GRGCYC	1 cut(s)	1014
BarI	GAAGNNNNNNTAC	4 cut(s)	593, 625, 1137, 1169
BbsI	GAAGAC	1 cut(s)	1238
Bbv12I	GWGCWC	2 cut(s)	59, 661
BbvI	GCAGC	1 cut(s)	962
BccI	CCATC	2 cut(s)	320, 1225
BceAI	ACGGC	2 cut(s)	206, 1133
BciT130I	CCWGG	4 cut(s)	710, 849, 881, 1251
BciVI	GTATCC	1 cut(s)	934
BcoDI	GTCTC	2 cut(s)	169, 260
BfaI	CTAG	3 cut(s)	129, 732, 1319
BfmI	CTRYAG	3 cut(s)	102, 369, 1143
BfrI	CTTAAG	1 cut(s)	1090
BfuAI	ACCTGC	1 cut(s)	301
BfuI	GTATCC	1 cut(s)	934
BisI	GCNGC	1 cut(s)	951
BlsI	GCNGC	1 cut(s)	952
Bme1390I	CCNGG	4 cut(s)	710, 849, 881, 1251
BmiI	GGNNCC	2 cut(s)	291, 846
BmrFI	CCNGG	4 cut(s)	710, 849, 881, 1251
BmrI	ACTGGG	1 cut(s)	594
BmsI	GCATC	3 cut(s)	237, 717, 1177
BmuI	ACTGGG	1 cut(s)	594
BpiI	GAAGAC	1 cut(s)	1238
BpmI	CTGGAG	2 cut(s)	1042, 1225
BsaI	GGTCTC	1 cut(s)	169
BsaJI	CCNNGG	1 cut(s)	1334
BsaXI	ACNNNNNCTCC	2 cut(s)	380, 410
Bsc4I	CCNNNNNNNGG	3 cut(s)	228, 1020, 1083
Bse1I	ACTGG	5 cut(s)	589, 942, 1025, 1208, 1244
Bse3DI	GCAATG	1 cut(s)	1054
BseBI	CCWGG	4 cut(s)	710, 849, 881, 1251
BseDI	CCNNGG	1 cut(s)	1334
BseGI	GGATG	3 cut(s)	732, 1217, 1278
BseLI	CCNNNNNNNGG	3 cut(s)	228, 1020, 1083
BseMI	GCAATG	1 cut(s)	1054
BseMII	CTCAG	1 cut(s)	311
BseNI	ACTGG	5 cut(s)	589, 942, 1025, 1208, 1244
BseXI	GCAGC	1 cut(s)	962
BseYI	CCCAGC	2 cut(s)	132, 159
BsgI	GTGCAG	1 cut(s)	506
Bsh1236I	CGCG	2 cut(s)	142, 169
BsiHKAI	GWGCWC	2 cut(s)	59, 661
BslFI	GGGAC	3 cut(s)	363, 846, 1100
BslI	CCNNNNNNNGG	3 cut(s)	228, 1020, 1083
BsmAI	GTCTC	2 cut(s)	169, 260
BsmFI	GGGAC	3 cut(s)	363, 846, 1100
BsmI	GAATGC	1 cut(s)	1339
Bso31I	GGTCTC	1 cut(s)	169
Bsp1286I	GDGCHC	3 cut(s)	59, 661, 1014
Bsp1407I	TGTACA	2 cut(s)	360, 1111
Bsp143I	GATC	5 cut(s)	642, 698, 969, 1027, 1057
BspACI	CCGC	1 cut(s)	142
BspCNI	CTCAG	1 cut(s)	310
BspFNI	CGCG	2 cut(s)	142, 169
BspHI	TCATGA	1 cut(s)	579
BspLI	GGNNCC	2 cut(s)	291, 846
BspMI	ACCTGC	1 cut(s)	301
BspPI	GGATC	1 cut(s)	1022
BspTI	CTTAAG	1 cut(s)	1090
BspTNI	GGTCTC	1 cut(s)	169
BsrDI	GCAATG	1 cut(s)	1054
BsrGI	TGTACA	2 cut(s)	360, 1111
BsrI	ACTGG	5 cut(s)	589, 942, 1025, 1208, 1244
BssECI	CCNNGG	1 cut(s)	1334
BssMI	GATC	5 cut(s)	642, 698, 969, 1027, 1057
BssT1I	CCWWGG	1 cut(s)	1334
Bst2UI	CCWGG	4 cut(s)	710, 849, 881, 1251
Bst4CI	ACNGT	7 cut(s)	103, 118, 555, 685, 837, 1111, 1138
Bst6I	CTCTTC	2 cut(s)	415, 596
BstAFI	CTTAAG	1 cut(s)	1090
BstAUI	TGTACA	2 cut(s)	360, 1111
BstC8I	GCNNGC	2 cut(s)	109, 575
BstDEI	CTNAG	2 cut(s)	297, 506
BstF5I	GGATG	3 cut(s)	732, 1217, 1278
BstFNI	CGCG	2 cut(s)	142, 169
BstKTI	GATC	5 cut(s)	645, 701, 972, 1030, 1060
BstMAI	GTCTC	2 cut(s)	169, 260
BstMBI	GATC	5 cut(s)	642, 698, 969, 1027, 1057
BstNI	CCWGG	4 cut(s)	710, 849, 881, 1251
BstNSI	RCATGY	2 cut(s)	740, 1196
BstSCI	CCNGG	4 cut(s)	708, 847, 879, 1249
BstSFI	CTRYAG	3 cut(s)	102, 369, 1143
BstUI	CGCG	2 cut(s)	142, 169
BstV1I	GCAGC	1 cut(s)	962
BstV2I	GAAGAC	1 cut(s)	1238
BstXI	CCANNNNNNTGG	1 cut(s)	159
BsuI	GTATCC	1 cut(s)	934
BtsCI	GGATG	3 cut(s)	732, 1217, 1278
BtsI	GCAGTG	1 cut(s)	216
BtsIMutI	CAGTG	8 cut(s)	216, 560, 803, 842, 935, 1018, 1107, 1237
BveI	ACCTGC	1 cut(s)	301
Cac8I	GCNNGC	2 cut(s)	109, 575
CaiI	CAGNNNCTG	2 cut(s)	1109, 1142
CciI	TCATGA	1 cut(s)	579
Csp6I	GTAC	3 cut(s)	75, 361, 1112
CviAII	CATG	9 cut(s)	272, 580, 737, 989, 1066, 1115, 1157, 1168, 1193
CviQI	GTAC	3 cut(s)	75, 361, 1112
DdeI	CTNAG	2 cut(s)	297, 506
DpnI	GATC	5 cut(s)	644, 700, 971, 1029, 1059
DpnII	GATC	5 cut(s)	642, 698, 969, 1027, 1057
DrdI	GACNNNNNNGTC	1 cut(s)	1168
DseDI	GACNNNNNNGTC	1 cut(s)	1168
Eam1104I	CTCTTC	2 cut(s)	415, 596
EarI	CTCTTC	2 cut(s)	415, 596
Eco130I	CCWWGG	1 cut(s)	1334
Eco24I	GRGCYC	1 cut(s)	1014
Eco31I	GGTCTC	1 cut(s)	169
Eco57I	CTGAAG	1 cut(s)	649
EcoRII	CCWGG	4 cut(s)	708, 847, 879, 1249
EcoT14I	CCWWGG	1 cut(s)	1334
EcoT38I	GRGCYC	1 cut(s)	1014
ErhI	CCWWGG	1 cut(s)	1334
FaeI	CATG	9 cut(s)	275, 583, 740, 992, 1069, 1118, 1160, 1171, 1196
FaqI	GGGAC	3 cut(s)	363, 846, 1100
FatI	CATG	9 cut(s)	271, 579, 736, 988, 1065, 1114, 1156, 1167, 1192
FauI	CCCGC	1 cut(s)	135
FblI	GTMKAC	1 cut(s)	609
Fnu4HI	GCNGC	1 cut(s)	951
FokI	GGATG	3 cut(s)	739, 1204, 1265
FriOI	GRGCYC	1 cut(s)	1014
Fsp4HI	GCNGC	1 cut(s)	951
FspBI	CTAG	3 cut(s)	129, 732, 1319
GluI	GCNGC	1 cut(s)	951
GsaI	CCCAGC	2 cut(s)	136, 163
GsuI	CTGGAG	2 cut(s)	1042, 1225
Hin1II	CATG	9 cut(s)	275, 583, 740, 992, 1069, 1118, 1160, 1171, 1196
HincII	GTYRAC	1 cut(s)	619
HindII	GTYRAC	1 cut(s)	619
HindIII	AAGCTT	2 cut(s)	503, 899
HinfI	GANTC	3 cut(s)	536, 560, 1326
HphI	GGTGA	1 cut(s)	1052
Hpy166II	GTNNAC	2 cut(s)	610, 619
Hpy188I	TCNGA	7 cut(s)	438, 647, 811, 819, 1002, 1105, 1181
Hpy188III	TCNNGA	5 cut(s)	90, 580, 1126, 1226, 1319
Hpy8I	GTNNAC	2 cut(s)	610, 619
Hpy99I	CGWCG	1 cut(s)	28
HpyAV	CCTTC	1 cut(s)	682
HpyCH4III	ACNGT	7 cut(s)	103, 118, 555, 685, 837, 1111, 1138
HpyCH4IV	ACGT	1 cut(s)	23
HpyCH4V	TGCA	4 cut(s)	315, 487, 1047, 1190
HpyF3I	CTNAG	2 cut(s)	297, 506
HpySE526I	ACGT	1 cut(s)	23
Hsp92II	CATG	9 cut(s)	275, 583, 740, 992, 1069, 1118, 1160, 1171, 1196
Kzo9I	GATC	5 cut(s)	642, 698, 969, 1027, 1057
LmnI	GCTCC	3 cut(s)	54, 388, 1206
Lsp1109I	GCAGC	1 cut(s)	962
LweI	GCATC	3 cut(s)	237, 717, 1177
MaeI	CTAG	3 cut(s)	129, 732, 1319
MaeII	ACGT	1 cut(s)	23
MaeIII	GTNAC	5 cut(s)	145, 561, 1051, 1159, 1199
MalI	GATC	5 cut(s)	644, 700, 971, 1029, 1059
MboI	GATC	5 cut(s)	642, 698, 969, 1027, 1057
MboII	GAAGA	4 cut(s)	432, 613, 1145, 1238
MfeI	CAATTG	1 cut(s)	400
MhlI	GDGCHC	3 cut(s)	59, 661, 1014
MluCI	AATT	8 cut(s)	7, 349, 400, 460, 567, 676, 805, 912
MlyI	GAGTC	1 cut(s)	569
MmeI	TCCRAC	4 cut(s)	704, 750, 865, 1055
MnlI	CCTC	9 cut(s)	503, 586, 741, 955, 1024, 1073, 1111, 1292, 1315
MseI	TTAA	4 cut(s)	480, 804, 1091, 1296
MslI	CAYNNNNRTG	3 cut(s)	276, 1023, 1344
MspCI	CTTAAG	1 cut(s)	1090
MspR9I	CCNGG	4 cut(s)	710, 849, 881, 1251
MunI	CAATTG	1 cut(s)	400
Mva1269I	GAATGC	1 cut(s)	1339
MvaI	CCWGG	4 cut(s)	710, 849, 881, 1251
MvnI	CGCG	2 cut(s)	142, 169
NdeII	GATC	5 cut(s)	642, 698, 969, 1027, 1057
NlaIII	CATG	9 cut(s)	275, 583, 740, 992, 1069, 1118, 1160, 1171, 1196
NlaIV	GGNNCC	2 cut(s)	291, 846
NmuCI	GTSAC	3 cut(s)	561, 1051, 1159
NspI	RCATGY	2 cut(s)	740, 1196
OliI	CACNNNNGTG	1 cut(s)	1023
PagI	TCATGA	1 cut(s)	579
PciI	ACATGT	2 cut(s)	736, 1192
PcsI	WCGNNNNNNNCGW	1 cut(s)	32
PctI	GAATGC	1 cut(s)	1339
PfeI	GAWTC	2 cut(s)	536, 1326
PflFI	GACNNNGTC	1 cut(s)	22
PfoI	TCCNGGA	2 cut(s)	847, 1249
PkrI	GCNGC	1 cut(s)	952
PleI	GAGTC	1 cut(s)	568
PpsI	GAGTC	1 cut(s)	568
PscI	ACATGT	2 cut(s)	736, 1192
PshBI	ATTAAT	1 cut(s)	804
Psp6I	CCWGG	4 cut(s)	708, 847, 879, 1249
PspFI	CCCAGC	2 cut(s)	132, 159
PspGI	CCWGG	4 cut(s)	708, 847, 879, 1249
PspN4I	GGNNCC	2 cut(s)	291, 846
PstNI	CAGNNNCTG	2 cut(s)	1109, 1142
PsyI	GACNNNGTC	1 cut(s)	22
RsaI	GTAC	3 cut(s)	76, 362, 1113
RsaNI	GTAC	3 cut(s)	75, 361, 1112
RseI	CAYNNNNRTG	3 cut(s)	276, 1023, 1344
SaqAI	TTAA	4 cut(s)	480, 804, 1091, 1296
SatI	GCNGC	1 cut(s)	951
Sau3AI	GATC	5 cut(s)	642, 698, 969, 1027, 1057
SchI	GAGTC	1 cut(s)	569
ScrFI	CCNGG	4 cut(s)	710, 849, 881, 1251
SduI	GDGCHC	3 cut(s)	59, 661, 1014
SfaNI	GCATC	3 cut(s)	237, 717, 1177
SfcI	CTRYAG	3 cut(s)	102, 369, 1143
SmiMI	CAYNNNNRTG	3 cut(s)	276, 1023, 1344
SmlI	CTYRAG	1 cut(s)	1090
SmoI	CTYRAG	1 cut(s)	1090
Sse9I	AATT	8 cut(s)	7, 349, 400, 460, 567, 676, 805, 912
SsiI	CCGC	1 cut(s)	142
SspMI	CTAG	3 cut(s)	129, 732, 1319
StyD4I	CCNGG	4 cut(s)	708, 847, 879, 1249
StyI	CCWWGG	1 cut(s)	1334
TaaI	ACNGT	7 cut(s)	103, 118, 555, 685, 837, 1111, 1138
TaiI	ACGT	1 cut(s)	26
TaqI	TCGA	5 cut(s)	302, 418, 687, 697, 1329
TaqII	GACCGA	1 cut(s)	1070
TasI	AATT	8 cut(s)	7, 349, 400, 460, 567, 676, 805, 912
TatI	WGTACW	3 cut(s)	74, 360, 1111
TfiI	GAWTC	2 cut(s)	536, 1326
Tru1I	TTAA	4 cut(s)	480, 804, 1091, 1296
Tru9I	TTAA	4 cut(s)	480, 804, 1091, 1296
TscAI	CASTG	8 cut(s)	223, 560, 803, 842, 942, 1025, 1114, 1244
TseFI	GTSAC	3 cut(s)	561, 1051, 1159
TseI	GCWGC	1 cut(s)	950
Tsp45I	GTSAC	3 cut(s)	561, 1051, 1159
TspDTI	ATGAA	4 cut(s)	193, 260, 1145, 1287
TspRI	CASTG	8 cut(s)	223, 560, 803, 842, 942, 1025, 1114, 1244
Tth111I	GACNNNGTC	1 cut(s)	22
Vha464I	CTTAAG	1 cut(s)	1090
VspI	ATTAAT	1 cut(s)	804
XbaI	TCTAGA	1 cut(s)	1318
XceI	RCATGY	2 cut(s)	740, 1196
XmiI	GTMKAC	1 cut(s)	609
XspI	CTAG	3 cut(s)	129, 732, 1319

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.