Rmu_sc0005127.1_g000009

WD repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005127.1
OG0005412
Physical Location & Seq
Reverse (-)
54960 .. 57189
2230 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1131 bp
ctgattgaggccattttgggtgttgagaagaaaccccaattgggtttggaagataaaggtgaatttgggggttgcaaagaggagagatcaagtggtgcatttatcttagttggtggggttagttgtgatttgagtaagaaattagaaggaggaggagttgagagtgatttgaaggtggagtctttgactctgaatgaggagaatgtagcccgagttgtcccggggaatgtcatgaatgtgagattttttccgagtactagtttgaggatggttgtggttgggaataaggctgggaatgttggattttggaatgttgattctaaggaaggggaggaaggtgggatatgtatgtatcacccacattctggtcccatttcggggatttctgttcaccaagattgcatgtcaaagatctttactagttgctatgatggatttatccgattgatggatgctgagaaagaggtgtttgatctagtatattcaagtggtgagactatatattctctcgctcaacagtcaaacaatgcaaagtgtttatactttgctgagggtcgtggaggtataagtatgtgggatgagagaacaggaaacatctcagcccaatggagtccgcatgatgatagaatcaattccatagactttaactcagaaaattcaaacatcatcaccactagttcaacagatggaactgcctgcatttgggatttgagatgtattgatgcagataaattcaaaagtttgaagacaattggccacaaaagggctgtgcattctgcctacttctcaccttctggaaggtcgctagtgacgacaagtcttgatgacacagttggtatatcaagtggagttaattttgaggacatatcaaggatatcccatgacaataatacaggcagatggattcctaagttcaaggcaatatggggctgggatgatgcatatgtcttcatcggaaataagaatagaggaatcgatgtcatctcccaccttcaaaaaagagcagttttcactttaaagagcccatatatgtctgcaattccgtgtagattggctgctcacccttataatgttgggatgctagcaggagctacaggtggaggccaagtttatgtatggacattgggataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
WD40

Protein Analysis

376

Amino Acids

41.0

Weight (kDa)

5.76

Isoelectric Point (pI)

41.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WD40_Gbeta PF25391 62 - 278 8.1e-08 G protein beta WD-40 repeat protein
WD40_Prp19 PF24814 76 - 289 8.7e-17 Prp19 WD40 domain
WDR55 PF24796 76 - 238 2.3e-12 WDR55
Beta-prop_WDR36-Utp21_2nd PF25168 90 - 280 3.8e-10 WDR36/Utp21 second beta-propeller domain
Beta-prop_THOC3 PF25174 99 - 341 8.3e-15 THOC3 beta-propeller domain
Beta-prop_WDR36-Utp21_1st PF25171 135 - 277 1.3e-08 WDR36/Utp21 first beta-propeller
WD40_WDHD1_1st PF24817 136 - 374 9.3e-08 WDHD1 first WD40 domain
WD40_CDC20-Fz PF24807 163 - 293 3.1e-12 CDC20/Fizzy WD40 domain
Beta-prop_WDR3_1st PF25173 169 - 278 3.1e-11 WDR3 first beta-propeller domain
EIF3I PF24805 170 - 266 1.4e-07 EIF3I
Beta-prop_EIPR1 PF23609 182 - 278 2.5e-08 EIPR1 beta-propeller
Beta-prop_WDR5 PF25175 189 - 373 8.6e-15 WDR5 beta-propeller domain
Beta-prop_RIG_2nd PF23775 199 - 272 1.3e-06 RIG second beta-propeller
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1068
AccB7I CCANNNNNTGG 1 cut(s) 365
AciI CCGC 1 cut(s) 614
AcoI YGGCCR 1 cut(s) 754
AcsI RAATTY 3 cut(s) 62, 655, 731
AfaI GTAC 1 cut(s) 256
AfiI CCNNNNNNNGG 7 cut(s) 41, 365, 377, 378, 448, 702, 763
AgsI TTSAA 8 cut(s) 172, 486, 660, 681, 736, 745, 916, 995
AhdI GACNNNNNGTC 1 cut(s) 816
AhlI ACTAGT 3 cut(s) 257, 419, 674
AjuI GAANNNNNNNTTGG 2 cut(s) 23, 55
AluBI AGCT 1 cut(s) 1091
AluI AGCT 1 cut(s) 1091
Alw26I GTCTC 1 cut(s) 488
Ama87I CYCGRG 2 cut(s) 210, 220
AoxI GGCC 3 cut(s) 9, 754, 1102
ApeKI GCWGC 1 cut(s) 1055
ApoI RAATTY 3 cut(s) 62, 655, 731
Asp700I GAANNNNTTC 1 cut(s) 631
AspS9I GGNCC 1 cut(s) 368
AsuC2I CCSGG 2 cut(s) 221, 222
AsuHPI GGTGA 7 cut(s) 71, 347, 383, 503, 661, 780, 1052
AsuNHI GCTAGC 1 cut(s) 1081
AvaI CYCGRG 2 cut(s) 210, 220
AvaII GGWCC 1 cut(s) 368
BalI TGGCCA 1 cut(s) 756
BanII GRGCYC 1 cut(s) 1025
BbsI GAAGAC 2 cut(s) 752, 940
BbvCI CCTCAGC 1 cut(s) 549
BbvI GCAGC 1 cut(s) 1042
BccI CCATC 5 cut(s) 262, 425, 442, 680, 894
BcnI CCSGG 2 cut(s) 221, 222
BcoDI GTCTC 1 cut(s) 488
BcuI ACTAGT 3 cut(s) 257, 419, 674
BfaI CTAG 6 cut(s) 258, 420, 476, 675, 806, 1082
BfmI CTRYAG 1 cut(s) 1092
BglII AGATCT 1 cut(s) 411
BisI GCNGC 1 cut(s) 1056
BlsI GCNGC 1 cut(s) 1057
BmcAI AGTACT 1 cut(s) 256
Bme1390I CCNGG 2 cut(s) 221, 222
Bme18I GGWCC 1 cut(s) 368
BmeRI GACNNNNNGTC 1 cut(s) 816
BmeT110I CYCGRG 2 cut(s) 210, 220
BmgT120I GGNCC 1 cut(s) 368
BmiI GGNNCC 1 cut(s) 370
BmrFI CCNGG 2 cut(s) 221, 222
BmsI GCATC 4 cut(s) 442, 712, 928, 1068
BmtI GCTAGC 1 cut(s) 1085
BpiI GAAGAC 2 cut(s) 752, 940
Bpu10I CCTNAGC 1 cut(s) 549
BpuMI CCSGG 2 cut(s) 221, 222
Bsa29I ATCGAT 1 cut(s) 975
BsaJI CCNNGG 2 cut(s) 220, 221
BsaXI ACNNNNNCTCC 4 cut(s) 141, 171, 1092, 1122
Bsc4I CCNNNNNNNGG 7 cut(s) 41, 365, 377, 378, 448, 702, 763
BseCI ATCGAT 1 cut(s) 975
BseDI CCNNGG 2 cut(s) 220, 221
BseGI GGATG 5 cut(s) 273, 457, 583, 940, 1083
BseLI CCNNNNNNNGG 7 cut(s) 41, 365, 377, 378, 448, 702, 763
BseMII CTCAG 4 cut(s) 447, 540, 612, 663
BseRI GAGGAG 4 cut(s) 95, 165, 168, 212
BseXI GCAGC 1 cut(s) 1042
BseYI CCCAGC 2 cut(s) 290, 930
BshFI GGCC 3 cut(s) 11, 756, 1104
BshVI ATCGAT 1 cut(s) 975
BsiHKCI CYCGRG 2 cut(s) 210, 220
BsiSI CCGG 1 cut(s) 221
BslFI GGGAC 2 cut(s) 203, 354
BslI CCNNNNNNNGG 7 cut(s) 41, 365, 377, 378, 448, 702, 763
BsmAI GTCTC 1 cut(s) 488
BsmFI GGGAC 2 cut(s) 203, 354
BsmI GAATGC 1 cut(s) 772
BsnI GGCC 3 cut(s) 11, 756, 1104
BsoBI CYCGRG 2 cut(s) 210, 220
Bsp1286I GDGCHC 1 cut(s) 1025
Bsp143I GATC 3 cut(s) 86, 411, 472
BspACI CCGC 1 cut(s) 614
BspANI GGCC 3 cut(s) 11, 756, 1104
BspCNI CTCAG 4 cut(s) 448, 541, 611, 662
BspDI ATCGAT 1 cut(s) 975
BspHI TCATGA 1 cut(s) 231
BspLI GGNNCC 1 cut(s) 370
BspOI GCTAGC 1 cut(s) 1085
BssECI CCNNGG 2 cut(s) 220, 221
BssMI GATC 3 cut(s) 86, 411, 472
Bst4CI ACNGT 2 cut(s) 519, 832
BstC8I GCNNGC 2 cut(s) 697, 1083
BstDEI CTNAG 7 cut(s) 106, 321, 456, 549, 598, 649, 909
BstF5I GGATG 5 cut(s) 273, 457, 583, 940, 1083
BstKTI GATC 3 cut(s) 89, 414, 475
BstMAI GTCTC 1 cut(s) 488
BstMBI GATC 3 cut(s) 86, 411, 472
BstNSI RCATGY 1 cut(s) 406
BstSCI CCNGG 2 cut(s) 219, 220
BstSFI CTRYAG 1 cut(s) 1092
BstV1I GCAGC 1 cut(s) 1042
BstV2I GAAGAC 2 cut(s) 752, 940
BstX2I RGATCY 1 cut(s) 411
BstYI RGATCY 1 cut(s) 411
Bsu15I ATCGAT 1 cut(s) 975
BsuRI GGCC 3 cut(s) 11, 756, 1104
BsuTUI ATCGAT 1 cut(s) 975
BtsCI GGATG 5 cut(s) 273, 457, 583, 940, 1083
Cac8I GCNNGC 2 cut(s) 697, 1083
CciI TCATGA 1 cut(s) 231
Cfr13I GGNCC 1 cut(s) 368
Cfr9I CCCGGG 1 cut(s) 220
ClaI ATCGAT 1 cut(s) 975
Csp6I GTAC 1 cut(s) 255
CviAII CATG 4 cut(s) 232, 403, 617, 881
CviQI GTAC 1 cut(s) 255
DdeI CTNAG 7 cut(s) 106, 321, 456, 549, 598, 649, 909
DpnI GATC 3 cut(s) 88, 413, 474
DpnII GATC 3 cut(s) 86, 411, 472
DraI TTTAAA 1 cut(s) 1017
DriI GACNNNNNGTC 1 cut(s) 816
EaeI YGGCCR 1 cut(s) 754
Eam1105I GACNNNNNGTC 1 cut(s) 816
Eco24I GRGCYC 1 cut(s) 1025
Eco32I GATATC 1 cut(s) 876
Eco47I GGWCC 1 cut(s) 368
Eco88I CYCGRG 2 cut(s) 210, 220
EcoRV GATATC 1 cut(s) 876
EcoT22I ATGCAT 1 cut(s) 943
EcoT38I GRGCYC 1 cut(s) 1025
FaeI CATG 4 cut(s) 235, 406, 620, 884
FaqI GGGAC 2 cut(s) 203, 354
FatI CATG 4 cut(s) 231, 402, 616, 880
FauNDI CATATG 1 cut(s) 943
Fnu4HI GCNGC 1 cut(s) 1056
FokI GGATG 5 cut(s) 280, 464, 590, 947, 1090
FriOI GRGCYC 1 cut(s) 1025
Fsp4HI GCNGC 1 cut(s) 1056
FspBI CTAG 6 cut(s) 258, 420, 476, 675, 806, 1082
GluI GCNGC 1 cut(s) 1056
GsaI CCCAGC 2 cut(s) 294, 934
HaeIII GGCC 3 cut(s) 11, 756, 1104
HapII CCGG 1 cut(s) 221
Hin1II CATG 4 cut(s) 235, 406, 620, 884
HinfI GANTC 7 cut(s) 179, 187, 317, 610, 627, 904, 972
HpaII CCGG 1 cut(s) 221
HphI GGTGA 7 cut(s) 71, 347, 383, 503, 661, 780, 1052
Hpy166II GTNNAC 1 cut(s) 391
Hpy188I TCNGA 5 cut(s) 192, 252, 443, 652, 956
Hpy188III TCNNGA 3 cut(s) 232, 795, 821
Hpy8I GTNNAC 1 cut(s) 391
HpyAV CCTTC 7 cut(s) 140, 166, 320, 329, 792, 801, 1001
HpyCH4III ACNGT 2 cut(s) 519, 832
HpyCH4V TGCA 9 cut(s) 75, 98, 402, 530, 699, 725, 772, 941, 1037
HpyF3I CTNAG 7 cut(s) 106, 321, 456, 549, 598, 649, 909
Hsp92II CATG 4 cut(s) 235, 406, 620, 884
Kzo9I GATC 3 cut(s) 86, 411, 472
LmnI GCTCC 1 cut(s) 1088
Lsp1109I GCAGC 1 cut(s) 1042
LweI GCATC 4 cut(s) 442, 712, 928, 1068
MaeI CTAG 6 cut(s) 258, 420, 476, 675, 806, 1082
MaeIII GTNAC 1 cut(s) 808
MalI GATC 3 cut(s) 88, 413, 474
MboI GATC 3 cut(s) 86, 411, 472
MboII GAAGA 4 cut(s) 40, 62, 757, 940
MfeI CAATTG 2 cut(s) 38, 750
MflI RGATCY 1 cut(s) 411
MhlI GDGCHC 1 cut(s) 1025
MlsI TGGCCA 1 cut(s) 756
MluCI AATT 9 cut(s) 38, 62, 140, 631, 655, 731, 750, 853, 1038
MluNI TGGCCA 1 cut(s) 756
MlyI GAGTC 3 cut(s) 181, 188, 619
MmeI TCCRAC 1 cut(s) 280
Mox20I TGGCCA 1 cut(s) 756
Mph1103I ATGCAT 1 cut(s) 943
MroXI GAANNNNTTC 1 cut(s) 631
MscI TGGCCA 1 cut(s) 756
MseI TTAA 3 cut(s) 645, 852, 1016
MslI CAYNNNNRTG 1 cut(s) 236
Msp20I TGGCCA 1 cut(s) 756
MspI CCGG 1 cut(s) 221
MspR9I CCNGG 2 cut(s) 221, 222
MunI CAATTG 2 cut(s) 38, 750
Mva1269I GAATGC 1 cut(s) 772
NciI CCSGG 2 cut(s) 221, 222
NdeI CATATG 1 cut(s) 943
NdeII GATC 3 cut(s) 86, 411, 472
NheI GCTAGC 1 cut(s) 1081
NlaIII CATG 4 cut(s) 235, 406, 620, 884
NlaIV GGNNCC 1 cut(s) 370
NmuCI GTSAC 1 cut(s) 808
NsiI ATGCAT 1 cut(s) 943
NspI RCATGY 1 cut(s) 406
PagI TCATGA 1 cut(s) 231
PcsI WCGNNNNNNNCGW 1 cut(s) 809
PctI GAATGC 1 cut(s) 772
PdmI GAANNNNTTC 1 cut(s) 631
PfeI GAWTC 4 cut(s) 317, 627, 904, 972
PflMI CCANNNNNTGG 1 cut(s) 365
PkrI GCNGC 1 cut(s) 1057
PleI GAGTC 3 cut(s) 181, 187, 618
PpsI GAGTC 3 cut(s) 181, 187, 618
PsiI TTATAA 1 cut(s) 1068
PspFI CCCAGC 2 cut(s) 290, 930
PspN4I GGNNCC 1 cut(s) 370
PspPI GGNCC 1 cut(s) 368
PsuI RGATCY 1 cut(s) 411
RsaI GTAC 1 cut(s) 256
RsaNI GTAC 1 cut(s) 255
RseI CAYNNNNRTG 1 cut(s) 236
SaqAI TTAA 3 cut(s) 645, 852, 1016
SatI GCNGC 1 cut(s) 1056
Sau3AI GATC 3 cut(s) 86, 411, 472
Sau96I GGNCC 1 cut(s) 368
ScaI AGTACT 1 cut(s) 256
SchI GAGTC 3 cut(s) 181, 188, 619
ScrFI CCNGG 2 cut(s) 221, 222
SduI GDGCHC 1 cut(s) 1025
SfaNI GCATC 4 cut(s) 442, 712, 928, 1068
SfcI CTRYAG 1 cut(s) 1092
SinI GGWCC 1 cut(s) 368
SmaI CCCGGG 1 cut(s) 222
SmiMI CAYNNNNRTG 1 cut(s) 236
SpeI ACTAGT 3 cut(s) 257, 419, 674
Sse9I AATT 9 cut(s) 38, 62, 140, 631, 655, 731, 750, 853, 1038
SsiI CCGC 1 cut(s) 614
SspMI CTAG 6 cut(s) 258, 420, 476, 675, 806, 1082
StyD4I CCNGG 2 cut(s) 219, 220
TaaI ACNGT 2 cut(s) 519, 832
TaqI TCGA 1 cut(s) 975
TasI AATT 9 cut(s) 38, 62, 140, 631, 655, 731, 750, 853, 1038
TatI WGTACW 1 cut(s) 254
TfiI GAWTC 4 cut(s) 317, 627, 904, 972
Tru1I TTAA 3 cut(s) 645, 852, 1016
Tru9I TTAA 3 cut(s) 645, 852, 1016
TseFI GTSAC 1 cut(s) 808
TseI GCWGC 1 cut(s) 1055
Tsp45I GTSAC 1 cut(s) 808
TspDTI ATGAA 2 cut(s) 248, 940
TspGWI ACGGA 1 cut(s) 1032
TspMI CCCGGG 1 cut(s) 220
Van91I CCANNNNNTGG 1 cut(s) 365
VpaK11BI GGWCC 1 cut(s) 368
XapI RAATTY 3 cut(s) 62, 655, 731
XceI RCATGY 1 cut(s) 406
XmaI CCCGGG 1 cut(s) 220
XmnI GAANNNNTTC 1 cut(s) 631
XspI CTAG 6 cut(s) 258, 420, 476, 675, 806, 1082
ZrmI AGTACT 1 cut(s) 256
Zsp2I ATGCAT 1 cut(s) 943
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.