Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005454.1

Orthogroup ID

OG0002935

Physical Location & Seq

Genomic Coordinates Forward (+)

89542 .. 91155

Gene Structure 1614 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005454.1_g000025.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1287 bp

atggtttcacaagactcacccccaaaccaagcctcaagtattctccaccatttcattgtgtctgactccatggcagctcaaaaccacatggcaaaccaacaccagcttgatgctgcttacgcctctaattttcgaaccagcactagcacataccctcagtctcttggtcaactccccagcattcattctcttgaggagagaatgtctagatcactaggccttcttcatgctcctccaacagttgcggcagagggatcggatcatatgagccacacaaggcttctaatggaccagcaccaagcactctcactgtcccttggctcacagatgcttcttcctcctaattctcattctgctcattatgtgaccgatgactattcgttcatggggaatgcgcttgcttcgtcctcaagctcgctgaatcagcagtctttggcagcagtcattgggaattcaagatatctaaagccagctcagtcactgttagaagagatagttagtgttggtggaaaggcagttgatatcagcagtgaaaaacattttgggaagatatatggtggaggtaggagaggctcaatgggcctttcttctgaattgaaagcagagttgtgttgcaatggcctcatctcagctgacaaacatgaatttcaatcgaaaatcgcaaacctcatcacattgctggaagaggttgaggacagatgtgagaagtactaccatcaaatggaagaagtgatgtcatcatttgagatggtagtgggtgcaggagcagcaaagtcttacacagctctggctctcaaggccatgtccaggcactttggcagcttaagggatgctataatgtcacatatatatgcagaaaagcgaaagttgatgcaagattttccgaaagtgagcggcggtctagcgcaactcagcttgtttgatcgagagtgtagacagaagagaatgtcccttcaacagcttgggattatccatggccaaaggcaagcagcttggagaccaattagagggctgcctgagacctcggtggcaattctccgcacttggcttttcgaacactttcttcatccttatcctaatgactctgagaagctaatgttggcatcacaaacaggcctgtccaagaaccaagtttcaaattggttcataaatgcacgggttcggctttggaaacctatgatagaggaaatgtacaaagaagaatttgcggattcttcacaagactcgaatccagtagctaatagttccatgaccggtgaaagcaacatagatcacacagatgattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Homeobox_KN POX

Protein Analysis

428

Amino Acids

47.43

Weight (kDa)

6.28

Isoelectric Point (pI)

54.12

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002935)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G75430 AT1G75430
fragaria_vesca	FvH4_2g39270 FvH4_2g39270 FvH4_2g39270
malus_domestica	MD08G1024300.v1.1 MD15G1021900.v1.1
prunus_persica	Prupe.1G373700_v2.0.a1 Prupe.1G373700_v2.0.a1 Prupe.1G373700_v2.0.a1 Prupe.1G373700_v2.0.a1 Prupe.1G373700_v2.0.a1
pyrus_communis	pycom08g01910 pycom15g01820
rosa_chinensis	RchiOBHm_Chr6g0245211 RchiOBHm_Chr6g0301741
rosa_laevigata	RLG00000011226 RLG00000015315 RLG00000021395
rosa_multiflora	Rmu_sc0001288.1_g000006 Rmu_sc0005454.1_g000025
rosa_roxburghii	Rroxscaffold_3G00242160 Rroxscaffold_7G00166460 Rroxscaffold_7G00215350
rosa_rugosa	Rorug05G0512900 Rorug05G0512900 Rorug06G0308600 Rorug06G0308700.1 Rorug06G0308800.1 Rorug06G0308900.1
rosa_samantha	Rh6AG028000 Rh6AG028100 Rh6AG421100 Rh6BG024200 Rh6BG427800 Rh6CG434400 Rh6DG421300
rosa_wichuraiana	Rw6G036450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	721
AccBSI	CCGCTC	1 cut(s)	894
AccI	GTMKAC	1 cut(s)	934
AciI	CCGC	5 cut(s)	245, 894, 897, 1039, 1208
AclWI	GGATC	2 cut(s)	262, 267
AcoI	YGGCCR	1 cut(s)	976
AcsI	RAATTY	3 cut(s)	451, 644, 1202
AfaI	GTAC	2 cut(s)	710, 1193
AfiI	CCNNNNNNNGG	3 cut(s)	721, 807, 1007
AflII	CTTAAG	1 cut(s)	823
AgeI	ACCGGT	1 cut(s)	1253
AgsI	TTSAA	5 cut(s)	456, 598, 650, 956, 1137
AjnI	CCWGG	1 cut(s)	806
AjuI	GAANNNNNNNTTGG	4 cut(s)	525, 557, 1082, 1114
Alw26I	GTCTC	3 cut(s)	165, 991, 1013
AlwI	GGATC	2 cut(s)	262, 267
AlwNI	CAGNNNCTG	1 cut(s)	481
AoxI	GGCC	6 cut(s)	217, 580, 619, 798, 976, 1114
ApeKI	GCWGC	7 cut(s)	74, 113, 437, 767, 819, 989, 1012
ApoI	RAATTY	3 cut(s)	451, 644, 1202
AsiGI	ACCGGT	1 cut(s)	1253
Asp700I	GAANNNNTTC	1 cut(s)	1059
AspLEI	GCGC	2 cut(s)	397, 907
AspS9I	GGNCC	2 cut(s)	289, 580
AsuHPI	GGTGA	2 cut(s)	9, 1268
AsuII	TTCGAA	2 cut(s)	133, 1053
AvaII	GGWCC	1 cut(s)	289
BalI	TGGCCA	1 cut(s)	978
BbvI	GCAGC	7 cut(s)	86, 100, 449, 779, 831, 999, 1001
BccI	CCATC	2 cut(s)	723, 742
BcgI	CGANNNNNNTGC	2 cut(s)	237, 271
BciT130I	CCWGG	1 cut(s)	808
BcoDI	GTCTC	3 cut(s)	165, 991, 1013
BfaI	CTAG	4 cut(s)	144, 207, 215, 902
BfrI	CTTAAG	1 cut(s)	823
BisI	GCNGC	9 cut(s)	75, 114, 246, 438, 768, 820, 895, 990, 1013
BlsI	GCNGC	9 cut(s)	76, 115, 247, 439, 769, 821, 896, 991, 1014
BmcAI	AGTACT	1 cut(s)	710
Bme1390I	CCNGG	1 cut(s)	808
Bme18I	GGWCC	1 cut(s)	289
BmgT120I	GGNCC	2 cut(s)	289, 580
BmrFI	CCNGG	1 cut(s)	808
BmsI	GCATC	5 cut(s)	100, 318, 820, 861, 1112
Bpu14I	TTCGAA	2 cut(s)	133, 1053
BpuEI	CTTGAG	4 cut(s)	19, 212, 394, 779
BsaI	GGTCTC	2 cut(s)	991, 1013
BsaJI	CCNNGG	4 cut(s)	69, 316, 973, 1023
BsaWI	WCCGGW	1 cut(s)	1253
BsaXI	ACNNNNNCTCC	2 cut(s)	188, 218
Bsc4I	CCNNNNNNNGG	3 cut(s)	721, 807, 1007
Bse118I	RCCGGY	1 cut(s)	1253
Bse1I	ACTGG	1 cut(s)	1232
Bse3DI	GCAATG	2 cut(s)	622, 674
BseBI	CCWGG	1 cut(s)	808
BseDI	CCNNGG	4 cut(s)	69, 316, 973, 1023
BseGI	GGATG	2 cut(s)	835, 1066
BseLI	CCNNNNNNNGG	3 cut(s)	721, 807, 1007
BseMI	GCAATG	2 cut(s)	622, 674
BseMII	CTCAG	6 cut(s)	170, 488, 642, 925, 1008, 1077
BseNI	ACTGG	1 cut(s)	1232
BseRI	GAGGAG	2 cut(s)	209, 222
BseXI	GCAGC	7 cut(s)	86, 100, 449, 779, 831, 999, 1001
BseYI	CCCAGC	1 cut(s)	176
BsgI	GTGCAG	1 cut(s)	780
BshFI	GGCC	6 cut(s)	219, 582, 621, 800, 978, 1116
BshTI	ACCGGT	1 cut(s)	1253
BsiSI	CCGG	1 cut(s)	1254
BslFI	GGGAC	2 cut(s)	298, 934
BslI	CCNNNNNNNGG	3 cut(s)	721, 807, 1007
BsmAI	GTCTC	3 cut(s)	165, 991, 1013
BsmFI	GGGAC	2 cut(s)	298, 934
BsmI	GAATGC	2 cut(s)	180, 397
BsnI	GGCC	6 cut(s)	219, 582, 621, 800, 978, 1116
Bso31I	GGTCTC	2 cut(s)	991, 1013
Bsp119I	TTCGAA	2 cut(s)	133, 1053
Bsp1407I	TGTACA	1 cut(s)	1191
Bsp143I	GATC	5 cut(s)	209, 254, 259, 922, 1270
Bsp19I	CCATGG	2 cut(s)	69, 973
BspACI	CCGC	5 cut(s)	245, 894, 897, 1039, 1208
BspANI	GGCC	6 cut(s)	219, 582, 621, 800, 978, 1116
BspCNI	CTCAG	6 cut(s)	169, 487, 641, 924, 1009, 1078
BspPI	GGATC	2 cut(s)	262, 267
BspT104I	TTCGAA	2 cut(s)	133, 1053
BspTI	CTTAAG	1 cut(s)	823
BspTNI	GGTCTC	2 cut(s)	991, 1013
BsrBI	CCGCTC	1 cut(s)	894
BsrDI	GCAATG	2 cut(s)	622, 674
BsrFI	RCCGGY	1 cut(s)	1253
BsrGI	TGTACA	1 cut(s)	1191
BsrI	ACTGG	1 cut(s)	1232
BssAI	RCCGGY	1 cut(s)	1253
BssECI	CCNNGG	4 cut(s)	69, 316, 973, 1023
BssMI	GATC	5 cut(s)	209, 254, 259, 922, 1270
BssT1I	CCWWGG	3 cut(s)	69, 316, 973
Bst2UI	CCWGG	1 cut(s)	808
Bst4CI	ACNGT	3 cut(s)	241, 312, 483
Bst6I	CTCTTC	3 cut(s)	483, 678, 935
BstAFI	CTTAAG	1 cut(s)	823
BstAUI	TGTACA	1 cut(s)	1191
BstBI	TTCGAA	2 cut(s)	133, 1053
BstC8I	GCNNGC	4 cut(s)	399, 416, 471, 987
BstDEI	CTNAG	6 cut(s)	156, 474, 628, 911, 1017, 1086
BstDSI	CCRYGG	2 cut(s)	69, 973
BstF5I	GGATG	2 cut(s)	835, 1066
BstHHI	GCGC	2 cut(s)	397, 907
BstKTI	GATC	5 cut(s)	212, 257, 262, 925, 1273
BstMAI	GTCTC	3 cut(s)	165, 991, 1013
BstMBI	GATC	5 cut(s)	209, 254, 259, 922, 1270
BstMWI	GCNNNNNNNGC	5 cut(s)	119, 424, 579, 767, 797
BstNI	CCWGG	1 cut(s)	808
BstSCI	CCNGG	1 cut(s)	806
BstV1I	GCAGC	7 cut(s)	86, 100, 449, 779, 831, 999, 1001
BsuRI	GGCC	6 cut(s)	219, 582, 621, 800, 978, 1116
BtgI	CCRYGG	2 cut(s)	69, 973
BtsCI	GGATG	2 cut(s)	835, 1066
BtsI	GCAGTG	1 cut(s)	535
BtsIMutI	CAGTG	3 cut(s)	308, 479, 535
Cac8I	GCNNGC	4 cut(s)	399, 416, 471, 987
CaiI	CAGNNNCTG	1 cut(s)	481
CfoI	GCGC	2 cut(s)	397, 907
Cfr10I	RCCGGY	1 cut(s)	1253
Cfr13I	GGNCC	2 cut(s)	289, 580
Csp6I	GTAC	2 cut(s)	709, 1192
CspAI	ACCGGT	1 cut(s)	1253
CviAII	CATG	8 cut(s)	70, 88, 227, 385, 641, 802, 974, 1249
CviQI	GTAC	2 cut(s)	709, 1192
DdeI	CTNAG	6 cut(s)	156, 474, 628, 911, 1017, 1086
DpnI	GATC	5 cut(s)	211, 256, 261, 924, 1272
DpnII	GATC	5 cut(s)	209, 254, 259, 922, 1270
EaeI	YGGCCR	1 cut(s)	976
Eam1104I	CTCTTC	3 cut(s)	483, 678, 935
EarI	CTCTTC	3 cut(s)	483, 678, 935
Eco130I	CCWWGG	3 cut(s)	69, 316, 973
Eco147I	AGGCCT	2 cut(s)	219, 1116
Eco31I	GGTCTC	2 cut(s)	991, 1013
Eco32I	GATATC	2 cut(s)	461, 523
Eco47I	GGWCC	1 cut(s)	289
EcoRI	GAATTC	1 cut(s)	451
EcoRII	CCWGG	1 cut(s)	806
EcoRV	GATATC	2 cut(s)	461, 523
EcoT14I	CCWWGG	3 cut(s)	69, 316, 973
ErhI	CCWWGG	3 cut(s)	69, 316, 973
FaeI	CATG	8 cut(s)	73, 91, 230, 388, 644, 805, 977, 1252
FaqI	GGGAC	2 cut(s)	298, 934
FatI	CATG	8 cut(s)	69, 87, 226, 384, 640, 801, 973, 1248
FauNDI	CATATG	1 cut(s)	264
FblI	GTMKAC	1 cut(s)	934
Fnu4HI	GCNGC	9 cut(s)	75, 114, 246, 438, 768, 820, 895, 990, 1013
FokI	GGATG	2 cut(s)	842, 1053
Fsp4HI	GCNGC	9 cut(s)	75, 114, 246, 438, 768, 820, 895, 990, 1013
FspBI	CTAG	4 cut(s)	144, 207, 215, 902
GlaI	GCGC	2 cut(s)	396, 906
GluI	GCNGC	9 cut(s)	75, 114, 246, 438, 768, 820, 895, 990, 1013
GsaI	CCCAGC	1 cut(s)	180
HaeIII	GGCC	6 cut(s)	219, 582, 621, 800, 978, 1116
HapII	CCGG	1 cut(s)	1254
HhaI	GCGC	2 cut(s)	397, 907
Hin1II	CATG	8 cut(s)	73, 91, 230, 388, 644, 805, 977, 1252
Hin6I	GCGC	2 cut(s)	395, 905
HinP1I	GCGC	2 cut(s)	395, 905
HincII	GTYRAC	1 cut(s)	170
HindII	GTYRAC	1 cut(s)	170
HinfI	GANTC	7 cut(s)	14, 65, 421, 1082, 1211, 1223, 1228
HpaII	CCGG	1 cut(s)	1254
HphI	GGTGA	2 cut(s)	9, 1268
Hpy166II	GTNNAC	2 cut(s)	170, 935
Hpy188I	TCNGA	5 cut(s)	64, 259, 592, 885, 1087
Hpy188III	TCNNGA	4 cut(s)	191, 207, 456, 926
Hpy8I	GTNNAC	2 cut(s)	170, 935
HpyAV	CCTTC	2 cut(s)	230, 962
HpyCH4III	ACNGT	3 cut(s)	241, 312, 483
HpyCH4V	TGCA	5 cut(s)	615, 761, 854, 874, 1154
HpyF10VI	GCNNNNNNNGC	5 cut(s)	119, 424, 579, 767, 797
HpyF3I	CTNAG	6 cut(s)	156, 474, 628, 911, 1017, 1086
Hsp92II	CATG	8 cut(s)	73, 91, 230, 388, 644, 805, 977, 1252
HspAI	GCGC	2 cut(s)	395, 905
Kzo9I	GATC	5 cut(s)	209, 254, 259, 922, 1270
LmnI	GCTCC	2 cut(s)	235, 764
Lsp1109I	GCAGC	7 cut(s)	86, 100, 449, 779, 831, 999, 1001
LweI	GCATC	5 cut(s)	100, 318, 820, 861, 1112
MaeI	CTAG	4 cut(s)	144, 207, 215, 902
MaeIII	GTNAC	3 cut(s)	364, 477, 840
MalI	GATC	5 cut(s)	211, 256, 261, 924, 1272
MbiI	CCGCTC	1 cut(s)	894
MboI	GATC	5 cut(s)	209, 254, 259, 922, 1270
MlsI	TGGCCA	1 cut(s)	978
MluCI	AATT	9 cut(s)	127, 343, 451, 593, 644, 1002, 1032, 1138, 1202
MluNI	TGGCCA	1 cut(s)	978
MlyI	GAGTC	4 cut(s)	8, 59, 1076, 1217
MmeI	TCCRAC	1 cut(s)	260
Mox20I	TGGCCA	1 cut(s)	978
MroXI	GAANNNNTTC	1 cut(s)	1059
MscI	TGGCCA	1 cut(s)	978
MseI	TTAA	2 cut(s)	824, 1285
MslI	CAYNNNNRTG	2 cut(s)	849, 1278
Msp20I	TGGCCA	1 cut(s)	978
MspA1I	CMGCKG	1 cut(s)	632
MspCI	CTTAAG	1 cut(s)	823
MspI	CCGG	1 cut(s)	1254
MspR9I	CCNGG	1 cut(s)	808
Mva1269I	GAATGC	2 cut(s)	180, 397
MvaI	CCWGG	1 cut(s)	808
MwoI	GCNNNNNNNGC	5 cut(s)	119, 424, 579, 767, 797
NcoI	CCATGG	2 cut(s)	69, 973
NdeI	CATATG	1 cut(s)	264
NdeII	GATC	5 cut(s)	209, 254, 259, 922, 1270
NlaIII	CATG	8 cut(s)	73, 91, 230, 388, 644, 805, 977, 1252
NmuCI	GTSAC	3 cut(s)	364, 477, 840
NspV	TTCGAA	2 cut(s)	133, 1053
PceI	AGGCCT	2 cut(s)	219, 1116
PctI	GAATGC	2 cut(s)	180, 397
PdmI	GAANNNNTTC	1 cut(s)	1059
PfeI	GAWTC	3 cut(s)	421, 1211, 1228
PflMI	CCANNNNNTGG	1 cut(s)	721
PinAI	ACCGGT	1 cut(s)	1253
PkrI	GCNGC	9 cut(s)	76, 115, 247, 439, 769, 821, 896, 991, 1014
PleI	GAGTC	4 cut(s)	8, 59, 1076, 1217
PpsI	GAGTC	4 cut(s)	8, 59, 1076, 1217
Psp6I	CCWGG	1 cut(s)	806
PspFI	CCCAGC	1 cut(s)	176
PspGI	CCWGG	1 cut(s)	806
PspPI	GGNCC	2 cut(s)	289, 580
PstNI	CAGNNNCTG	1 cut(s)	481
PvuII	CAGCTG	1 cut(s)	632
RsaI	GTAC	2 cut(s)	710, 1193
RsaNI	GTAC	2 cut(s)	709, 1192
RseI	CAYNNNNRTG	2 cut(s)	849, 1278
SaqAI	TTAA	2 cut(s)	824, 1285
SatI	GCNGC	9 cut(s)	75, 114, 246, 438, 768, 820, 895, 990, 1013
Sau3AI	GATC	5 cut(s)	209, 254, 259, 922, 1270
Sau96I	GGNCC	2 cut(s)	289, 580
ScaI	AGTACT	1 cut(s)	710
SchI	GAGTC	4 cut(s)	8, 59, 1076, 1217
ScrFI	CCNGG	1 cut(s)	808
SfaNI	GCATC	5 cut(s)	100, 318, 820, 861, 1112
SfuI	TTCGAA	2 cut(s)	133, 1053
SinI	GGWCC	1 cut(s)	289
SmiMI	CAYNNNNRTG	2 cut(s)	849, 1278
SmlI	CTYRAG	5 cut(s)	34, 191, 409, 794, 823
SmoI	CTYRAG	5 cut(s)	34, 191, 409, 794, 823
Sse9I	AATT	9 cut(s)	127, 343, 451, 593, 644, 1002, 1032, 1138, 1202
SseBI	AGGCCT	2 cut(s)	219, 1116
SsiI	CCGC	5 cut(s)	245, 894, 897, 1039, 1208
SspMI	CTAG	4 cut(s)	144, 207, 215, 902
StuI	AGGCCT	2 cut(s)	219, 1116
StyD4I	CCNGG	1 cut(s)	806
StyI	CCWWGG	3 cut(s)	69, 316, 973
TaaI	ACNGT	3 cut(s)	241, 312, 483
TaqI	TCGA	5 cut(s)	133, 653, 925, 1053, 1226
TaqII	GACCGA	1 cut(s)	383
TasI	AATT	9 cut(s)	127, 343, 451, 593, 644, 1002, 1032, 1138, 1202
TatI	WGTACW	2 cut(s)	708, 1191
TauI	GCSGC	2 cut(s)	248, 897
TfiI	GAWTC	3 cut(s)	421, 1211, 1228
Tru1I	TTAA	2 cut(s)	824, 1285
Tru9I	TTAA	2 cut(s)	824, 1285
TscAI	CASTG	3 cut(s)	315, 486, 535
TseFI	GTSAC	3 cut(s)	364, 477, 840
TseI	GCWGC	7 cut(s)	74, 113, 437, 767, 819, 989, 1012
Tsp45I	GTSAC	3 cut(s)	364, 477, 840
TspDTI	ATGAA	7 cut(s)	43, 173, 215, 373, 657, 1055, 1135
TspRI	CASTG	3 cut(s)	315, 486, 535
Van91I	CCANNNNNTGG	1 cut(s)	721
Vha464I	CTTAAG	1 cut(s)	823
VpaK11BI	GGWCC	1 cut(s)	289
XapI	RAATTY	3 cut(s)	451, 644, 1202
XbaI	TCTAGA	1 cut(s)	206
XmiI	GTMKAC	1 cut(s)	934
XmnI	GAANNNNTTC	1 cut(s)	1059
XspI	CTAG	4 cut(s)	144, 207, 215, 902
ZrmI	AGTACT	1 cut(s)	710

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.