Rmu_sc0006908.1_g000001

Belongs to the Casparian strip membrane proteins (CASP) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006908.1
OG0004667
Physical Location & Seq
Forward (+)
500 .. 1652
1153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006908.1_g000001.1.cds

Sequence Viewer

Length: 312 bp
atggggcttgaattcctttggagttttggacttgcttgccttgattttcatgctttgaggtcaaagaggagcttgcagaatcctgttttagtgagcctatttgttgttggagactgggtgactgctactctttcactggcaggtgcatgctcatcagctggggtggcggttctgttctcaagagacttgggttactgctccaagacatttccatgcaccaggttccaaatcggggtggctttcgcttttatctcatggttcctcctcgctatttcctcactagtcatgttttggctgctaggtgcagtgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF588

Protein Analysis

103

Amino Acids

11.22

Weight (kDa)

8.49

Isoelectric Point (pI)

47.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 131
Acc36I ACCTGC 1 cut(s) 131
AciI CCGC 1 cut(s) 167
AcsI RAATTY 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 232
AgsI TTSAA 1 cut(s) 11
AhlI ACTAGT 1 cut(s) 280
AjnI CCWGG 1 cut(s) 218
AluBI AGCT 2 cut(s) 72, 158
AluI AGCT 2 cut(s) 72, 158
Alw26I GTCTC 2 cut(s) 105, 177
ApeKI GCWGC 1 cut(s) 295
ApoI RAATTY 1 cut(s) 11
AsuHPI GGTGA 1 cut(s) 130
BbvI GCAGC 1 cut(s) 282
BciT130I CCWGG 1 cut(s) 220
BcoDI GTCTC 2 cut(s) 105, 177
BcuI ACTAGT 1 cut(s) 280
BfaI CTAG 2 cut(s) 281, 299
BfuAI ACCTGC 1 cut(s) 131
BisI GCNGC 1 cut(s) 296
BlsI GCNGC 1 cut(s) 297
Bme1390I CCNGG 1 cut(s) 220
BmiI GGNNCC 2 cut(s) 224, 260
BmrFI CCNGG 1 cut(s) 220
BmrI ACTGGG 1 cut(s) 124
BmuI ACTGGG 1 cut(s) 124
BpuEI CTTGAG 1 cut(s) 163
BsaXI ACNNNNNCTCC 2 cut(s) 102, 132
Bsc4I CCNNNNNNNGG 1 cut(s) 232
Bse1I ACTGG 2 cut(s) 119, 141
BseBI CCWGG 1 cut(s) 220
BseLI CCNNNNNNNGG 1 cut(s) 232
BseNI ACTGG 2 cut(s) 119, 141
BseRI GAGGAG 2 cut(s) 82, 254
BseXI GCAGC 1 cut(s) 282
BseYI CCCAGC 1 cut(s) 158
BslI CCNNNNNNNGG 1 cut(s) 232
BsmAI GTCTC 2 cut(s) 105, 177
BspACI CCGC 1 cut(s) 167
BspLI GGNNCC 2 cut(s) 224, 260
BspMI ACCTGC 1 cut(s) 131
BsrI ACTGG 2 cut(s) 119, 141
Bst2UI CCWGG 1 cut(s) 220
BstC8I GCNNGC 3 cut(s) 37, 74, 148
BstMAI GTCTC 2 cut(s) 105, 177
BstMWI GCNNNNNNNGC 1 cut(s) 164
BstNI CCWGG 1 cut(s) 220
BstNSI RCATGY 1 cut(s) 150
BstSCI CCNGG 1 cut(s) 218
BstV1I GCAGC 1 cut(s) 282
BtsI GCAGTG 1 cut(s) 312
BtsIMutI CAGTG 2 cut(s) 134, 312
BveI ACCTGC 1 cut(s) 131
Cac8I GCNNGC 3 cut(s) 37, 74, 148
CsiI ACCWGGT 1 cut(s) 218
CviAII CATG 5 cut(s) 50, 147, 213, 255, 286
CviJI RGCY 6 cut(s) 7, 72, 96, 158, 239, 295
CviKI_1 RGCY 6 cut(s) 7, 72, 96, 158, 239, 295
EcoRI GAATTC 1 cut(s) 11
EcoRII CCWGG 1 cut(s) 218
FaeI CATG 5 cut(s) 53, 150, 216, 258, 289
FaiI YATR 5 cut(s) 51, 148, 214, 256, 287
FalI AAGNNNNNCTT 2 cut(s) 56, 88
FatI CATG 5 cut(s) 49, 146, 212, 254, 285
Fnu4HI GCNGC 1 cut(s) 296
Fsp4HI GCNGC 1 cut(s) 296
FspBI CTAG 2 cut(s) 281, 299
GluI GCNGC 1 cut(s) 296
GsaI CCCAGC 1 cut(s) 162
Hin1II CATG 5 cut(s) 53, 150, 216, 258, 289
HinfI GANTC 1 cut(s) 79
HphI GGTGA 1 cut(s) 130
Hpy188III TCNNGA 1 cut(s) 180
HpyCH4V TGCA 4 cut(s) 76, 146, 216, 305
HpyF10VI GCNNNNNNNGC 1 cut(s) 164
Hsp92II CATG 5 cut(s) 53, 150, 216, 258, 289
LmnI GCTCC 2 cut(s) 69, 203
LpnPI CCDG 7 cut(s) 96, 100, 122, 126, 144, 205, 232
Lsp1109I GCAGC 1 cut(s) 282
MabI ACCWGGT 1 cut(s) 218
MaeI CTAG 2 cut(s) 281, 299
MaeIII GTNAC 2 cut(s) 118, 191
MluCI AATT 1 cut(s) 11
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 5 cut(s) 51, 60, 272, 275, 286
MslI CAYNNNNRTG 1 cut(s) 211
MspA1I CMGCKG 1 cut(s) 158
MspR9I CCNGG 1 cut(s) 220
MvaI CCWGG 1 cut(s) 220
MwoI GCNNNNNNNGC 1 cut(s) 164
NlaIII CATG 5 cut(s) 53, 150, 216, 258, 289
NlaIV GGNNCC 2 cut(s) 224, 260
NmuCI GTSAC 1 cut(s) 118
NspI RCATGY 1 cut(s) 150
PaeI GCATGC 1 cut(s) 150
PaqCI CACCTGC 1 cut(s) 131
PfeI GAWTC 1 cut(s) 79
PkrI GCNGC 1 cut(s) 297
Psp6I CCWGG 1 cut(s) 218
PspFI CCCAGC 1 cut(s) 158
PspGI CCWGG 1 cut(s) 218
PspN4I GGNNCC 2 cut(s) 224, 260
PvuII CAGCTG 1 cut(s) 158
RseI CAYNNNNRTG 1 cut(s) 211
SatI GCNGC 1 cut(s) 296
ScrFI CCNGG 1 cut(s) 220
SetI ASST 6 cut(s) 62, 74, 145, 160, 224, 304
SexAI ACCWGGT 1 cut(s) 218
SmiMI CAYNNNNRTG 1 cut(s) 211
SmlI CTYRAG 1 cut(s) 178
SmoI CTYRAG 1 cut(s) 178
SpeI ACTAGT 1 cut(s) 280
SphI GCATGC 1 cut(s) 150
Sse9I AATT 1 cut(s) 11
SsiI CCGC 1 cut(s) 167
SspMI CTAG 2 cut(s) 281, 299
StyD4I CCNGG 1 cut(s) 218
TasI AATT 1 cut(s) 11
TfiI GAWTC 1 cut(s) 79
TscAI CASTG 2 cut(s) 141, 312
TseFI GTSAC 1 cut(s) 118
TseI GCWGC 1 cut(s) 295
Tsp45I GTSAC 1 cut(s) 118
TspDTI ATGAA 1 cut(s) 38
TspRI CASTG 2 cut(s) 141, 312
XapI RAATTY 1 cut(s) 11
XceI RCATGY 1 cut(s) 150
XspI CTAG 2 cut(s) 281, 299
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.