Rroxscaffold_4G00288470

Belongs to the Casparian strip membrane proteins (CASP) family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
9262893 .. 9266171
3279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00288470.1

Sequence Viewer

Length: 459 bp
ATGAAGGTGTTTTTTGGGAGTCCAGGAAAGATAAGTGGGCTGCTCCTCAGAATTGGACAGTGCTTTTTTGCTGCTGCTTCTATTGGGGTCATGGTCTCTGCTCATGGCTTCTACACCTCTACTGCATTTTGCTATTTAATTGCATCAATGGGGCTTGAATTCCTTTGGAGTTTTGGACTTGCTTGCCTTGATTTTCATGCTTTGAGGTCAAAGAGGAGCTTGCAGAATCCTGTTTTAGTGAGCCTATTTGTTGTTGGAGACTGGGTGACTGCTACTCTTTCACTGGCAGGTGCATGCTCATCAGCTGGGGTGGCAGTTCTGTTCTCAAGAGACTTGGGTTACTGCTCCAAGATATTTCCATGCACCAGGTTCCAAATCGGGGTGGCTTTCGCTTTTGTCTCATGGTTCCTCCTCGCTATTTCCTCACTAGTCATGTTTTGGCTGCTAGGTGCAGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

152

Amino Acids

16.37

Weight (kDa)

9.08

Isoelectric Point (pI)

36.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CASP_dom PF04535 7 - 137 4e-26 Casparian strip membrane protein domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 278
Acc36I ACCTGC 1 cut(s) 278
AcsI RAATTY 1 cut(s) 158
AfiI CCNNNNNNNGG 1 cut(s) 379
AgsI TTSAA 1 cut(s) 158
AhlI ACTAGT 1 cut(s) 427
AjnI CCWGG 2 cut(s) 22, 365
AluBI AGCT 2 cut(s) 219, 305
AluI AGCT 2 cut(s) 219, 305
Alw26I GTCTC 4 cut(s) 100, 252, 324, 403
ApeKI GCWGC 4 cut(s) 40, 71, 74, 442
ApoI RAATTY 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 277
BbvI GCAGC 4 cut(s) 27, 58, 61, 429
BciT130I CCWGG 2 cut(s) 24, 367
BcoDI GTCTC 4 cut(s) 100, 252, 324, 403
BcuI ACTAGT 1 cut(s) 427
BfaI CTAG 2 cut(s) 428, 446
BfuAI ACCTGC 1 cut(s) 278
BisI GCNGC 4 cut(s) 41, 72, 75, 443
BlsI GCNGC 4 cut(s) 42, 73, 76, 444
Bme1390I CCNGG 2 cut(s) 24, 367
BmiI GGNNCC 2 cut(s) 371, 407
BmrFI CCNGG 2 cut(s) 24, 367
BmrI ACTGGG 1 cut(s) 271
BmsI GCATC 1 cut(s) 152
BmuI ACTGGG 1 cut(s) 271
BpuEI CTTGAG 1 cut(s) 310
BsaI GGTCTC 1 cut(s) 100
BsaXI ACNNNNNCTCC 2 cut(s) 249, 279
Bsc4I CCNNNNNNNGG 1 cut(s) 379
Bse1I ACTGG 2 cut(s) 266, 288
BseBI CCWGG 2 cut(s) 24, 367
BseLI CCNNNNNNNGG 1 cut(s) 379
BseMII CTCAG 1 cut(s) 61
BseNI ACTGG 2 cut(s) 266, 288
BseRI GAGGAG 3 cut(s) 35, 229, 401
BseXI GCAGC 4 cut(s) 27, 58, 61, 429
BseYI CCCAGC 1 cut(s) 305
BslI CCNNNNNNNGG 1 cut(s) 379
BsmAI GTCTC 4 cut(s) 100, 252, 324, 403
Bso31I GGTCTC 1 cut(s) 100
BspCNI CTCAG 1 cut(s) 60
BspLI GGNNCC 2 cut(s) 371, 407
BspMI ACCTGC 1 cut(s) 278
BspTNI GGTCTC 1 cut(s) 100
BsrI ACTGG 2 cut(s) 266, 288
Bst2UI CCWGG 2 cut(s) 24, 367
Bst4CI ACNGT 1 cut(s) 60
BstC8I GCNNGC 3 cut(s) 184, 221, 295
BstDEI CTNAG 1 cut(s) 47
BstMAI GTCTC 4 cut(s) 100, 252, 324, 403
BstMWI GCNNNNNNNGC 1 cut(s) 311
BstNI CCWGG 2 cut(s) 24, 367
BstNSI RCATGY 1 cut(s) 297
BstSCI CCNGG 2 cut(s) 22, 365
BstV1I GCAGC 4 cut(s) 27, 58, 61, 429
BtsI GCAGTG 1 cut(s) 459
BtsIMutI CAGTG 3 cut(s) 65, 281, 459
BveI ACCTGC 1 cut(s) 278
Cac8I GCNNGC 3 cut(s) 184, 221, 295
CsiI ACCWGGT 1 cut(s) 365
CviAII CATG 7 cut(s) 91, 104, 197, 294, 360, 402, 433
CviJI RGCY 8 cut(s) 40, 108, 154, 219, 243, 305, 386, 442
CviKI_1 RGCY 8 cut(s) 40, 108, 154, 219, 243, 305, 386, 442
DdeI CTNAG 1 cut(s) 47
Eco31I GGTCTC 1 cut(s) 100
EcoRI GAATTC 1 cut(s) 158
EcoRII CCWGG 2 cut(s) 22, 365
FaeI CATG 7 cut(s) 94, 107, 200, 297, 363, 405, 436
FaiI YATR 7 cut(s) 92, 105, 198, 295, 361, 403, 434
FalI AAGNNNNNCTT 2 cut(s) 203, 235
FatI CATG 7 cut(s) 90, 103, 196, 293, 359, 401, 432
Fnu4HI GCNGC 4 cut(s) 41, 72, 75, 443
Fsp4HI GCNGC 4 cut(s) 41, 72, 75, 443
FspBI CTAG 2 cut(s) 428, 446
GluI GCNGC 4 cut(s) 41, 72, 75, 443
GsaI CCCAGC 1 cut(s) 309
Hin1II CATG 7 cut(s) 94, 107, 200, 297, 363, 405, 436
HinfI GANTC 2 cut(s) 19, 226
HphI GGTGA 1 cut(s) 277
Hpy188I TCNGA 1 cut(s) 50
Hpy188III TCNNGA 1 cut(s) 327
HpyCH4III ACNGT 1 cut(s) 60
HpyCH4V TGCA 6 cut(s) 125, 143, 223, 293, 363, 452
HpyF10VI GCNNNNNNNGC 1 cut(s) 311
HpyF3I CTNAG 1 cut(s) 47
Hsp92II CATG 7 cut(s) 94, 107, 200, 297, 363, 405, 436
LmnI GCTCC 3 cut(s) 48, 216, 350
LpnPI CCDG 9 cut(s) 9, 36, 243, 247, 269, 273, 291, 352, 379
Lsp1109I GCAGC 4 cut(s) 27, 58, 61, 429
LweI GCATC 1 cut(s) 152
MabI ACCWGGT 1 cut(s) 365
MaeI CTAG 2 cut(s) 428, 446
MaeIII GTNAC 2 cut(s) 265, 338
MluCI AATT 3 cut(s) 51, 138, 158
MlyI GAGTC 1 cut(s) 28
MmeI TCCRAC 1 cut(s) 235
MnlI CCTC 7 cut(s) 56, 127, 198, 207, 419, 422, 433
MseI TTAA 1 cut(s) 137
MspA1I CMGCKG 1 cut(s) 305
MspR9I CCNGG 2 cut(s) 24, 367
MvaI CCWGG 2 cut(s) 24, 367
MwoI GCNNNNNNNGC 1 cut(s) 311
NlaIII CATG 7 cut(s) 94, 107, 200, 297, 363, 405, 436
NlaIV GGNNCC 2 cut(s) 371, 407
NmuCI GTSAC 1 cut(s) 265
NspI RCATGY 1 cut(s) 297
PaeI GCATGC 1 cut(s) 297
PaqCI CACCTGC 1 cut(s) 278
PfeI GAWTC 1 cut(s) 226
PfoI TCCNGGA 1 cut(s) 22
PkrI GCNGC 4 cut(s) 42, 73, 76, 444
PleI GAGTC 1 cut(s) 27
PpsI GAGTC 1 cut(s) 27
Psp6I CCWGG 2 cut(s) 22, 365
PspFI CCCAGC 1 cut(s) 305
PspGI CCWGG 2 cut(s) 22, 365
PspN4I GGNNCC 2 cut(s) 371, 407
PvuII CAGCTG 1 cut(s) 305
SaqAI TTAA 1 cut(s) 137
SatI GCNGC 4 cut(s) 41, 72, 75, 443
SchI GAGTC 1 cut(s) 28
ScrFI CCNGG 2 cut(s) 24, 367
SetI ASST 8 cut(s) 9, 119, 209, 221, 292, 307, 371, 451
SexAI ACCWGGT 1 cut(s) 365
SfaNI GCATC 1 cut(s) 152
SmlI CTYRAG 1 cut(s) 325
SmoI CTYRAG 1 cut(s) 325
SpeI ACTAGT 1 cut(s) 427
SphI GCATGC 1 cut(s) 297
Sse9I AATT 3 cut(s) 51, 138, 158
SspMI CTAG 2 cut(s) 428, 446
StyD4I CCNGG 2 cut(s) 22, 365
TaaI ACNGT 1 cut(s) 60
TasI AATT 3 cut(s) 51, 138, 158
TfiI GAWTC 1 cut(s) 226
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TscAI CASTG 3 cut(s) 65, 288, 459
TseFI GTSAC 1 cut(s) 265
TseI GCWGC 4 cut(s) 40, 71, 74, 442
Tsp45I GTSAC 1 cut(s) 265
TspDTI ATGAA 2 cut(s) 17, 185
TspRI CASTG 3 cut(s) 65, 288, 459
XapI RAATTY 1 cut(s) 158
XceI RCATGY 1 cut(s) 297
XspI CTAG 2 cut(s) 428, 446
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.