Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011394.1

Orthogroup ID

OG0004667

Physical Location & Seq

Genomic Coordinates Forward (+)

33460 .. 36265

Gene Structure 2806 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011394.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 459 bp

atgaaggtgttttttgggagtccaggaaacataagtgggctgctcctcagaattggacagtgcttttttgctgctgcttctattggggtcatggtctctgctcatggcttctacacctctactgcattttgctatttaattgcatcaatggggcttgaattcctttggagttttggacttgcttgccttgattttcatgctttgaggtcaaagaggagcttgcagaatcctgttttagtgagcctatttgttgttggagactgggtgactgctactctttcactggcaggtgcatgctcatcagctggggtggcggttctgttctcaagagacttgggttactgctccaagacatttccatgcaccaggttccaaatcggggtggctttcgcttttatctcatggttcctcctcgctatttcctcactagtcatgttttggctgctaggtgcagtgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF588

Protein Analysis

152

Amino Acids

16.35

Weight (kDa)

8.88

Isoelectric Point (pI)

41.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004667)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G53850 AT3G53850 AT3G53850 AT5G02060
fragaria_vesca	FvH4_6g13050 FvH4_7g23400
malus_domestica	MD01G1140000.v1.1 MD04G1136000.v1.1 MD07G1204300.v1.1
prunus_persica	Prupe.2G240600_v2.0.a1
pyrus_communis	pycom01g16050 pycom04g12300 pycom07g19090
rosa_chinensis	RchiOBHm_Chr1g0368521 RchiOBHm_Chr3g0465321
rosa_laevigata	RLG00000024647 RLG00000027206
rosa_multiflora	Rmu_sc0005190.1_g000007 Rmu_sc0006908.1_g000001 Rmu_sc0011394.1_g000009
rosa_roxburghii	Rroxscaffold_4G00288470 Rroxscaffold_6G00415130
rosa_rugosa	Rorug01G0342600 Rorug03G0076200
rosa_samantha	Rh1BG313100 Rh1CG327800 Rh1DG344500 Rh3BG140900 Rh3CG141900 Rh3DG142000
rosa_wichuraiana	Rw3G011530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	278
Acc36I	ACCTGC	1 cut(s)	278
AciI	CCGC	1 cut(s)	314
AcsI	RAATTY	1 cut(s)	158
AfiI	CCNNNNNNNGG	1 cut(s)	379
AgsI	TTSAA	1 cut(s)	158
AhlI	ACTAGT	1 cut(s)	427
AjnI	CCWGG	2 cut(s)	22, 365
AluBI	AGCT	2 cut(s)	219, 305
AluI	AGCT	2 cut(s)	219, 305
Alw26I	GTCTC	3 cut(s)	100, 252, 324
ApeKI	GCWGC	4 cut(s)	40, 71, 74, 442
ApoI	RAATTY	1 cut(s)	158
AsuHPI	GGTGA	1 cut(s)	277
BbvI	GCAGC	4 cut(s)	27, 58, 61, 429
BciT130I	CCWGG	2 cut(s)	24, 367
BcoDI	GTCTC	3 cut(s)	100, 252, 324
BcuI	ACTAGT	1 cut(s)	427
BfaI	CTAG	2 cut(s)	428, 446
BfuAI	ACCTGC	1 cut(s)	278
BisI	GCNGC	4 cut(s)	41, 72, 75, 443
BlsI	GCNGC	4 cut(s)	42, 73, 76, 444
Bme1390I	CCNGG	2 cut(s)	24, 367
BmiI	GGNNCC	2 cut(s)	371, 407
BmrFI	CCNGG	2 cut(s)	24, 367
BmrI	ACTGGG	1 cut(s)	271
BmsI	GCATC	1 cut(s)	152
BmuI	ACTGGG	1 cut(s)	271
BpuEI	CTTGAG	1 cut(s)	310
BsaI	GGTCTC	1 cut(s)	100
BsaXI	ACNNNNNCTCC	2 cut(s)	249, 279
Bsc4I	CCNNNNNNNGG	1 cut(s)	379
Bse1I	ACTGG	2 cut(s)	266, 288
BseBI	CCWGG	2 cut(s)	24, 367
BseLI	CCNNNNNNNGG	1 cut(s)	379
BseMII	CTCAG	1 cut(s)	61
BseNI	ACTGG	2 cut(s)	266, 288
BseRI	GAGGAG	3 cut(s)	35, 229, 401
BseXI	GCAGC	4 cut(s)	27, 58, 61, 429
BseYI	CCCAGC	1 cut(s)	305
BslI	CCNNNNNNNGG	1 cut(s)	379
BsmAI	GTCTC	3 cut(s)	100, 252, 324
Bso31I	GGTCTC	1 cut(s)	100
BspACI	CCGC	1 cut(s)	314
BspCNI	CTCAG	1 cut(s)	60
BspLI	GGNNCC	2 cut(s)	371, 407
BspMI	ACCTGC	1 cut(s)	278
BspTNI	GGTCTC	1 cut(s)	100
BsrI	ACTGG	2 cut(s)	266, 288
Bst2UI	CCWGG	2 cut(s)	24, 367
Bst4CI	ACNGT	1 cut(s)	60
BstC8I	GCNNGC	3 cut(s)	184, 221, 295
BstDEI	CTNAG	1 cut(s)	47
BstMAI	GTCTC	3 cut(s)	100, 252, 324
BstMWI	GCNNNNNNNGC	1 cut(s)	311
BstNI	CCWGG	2 cut(s)	24, 367
BstNSI	RCATGY	1 cut(s)	297
BstSCI	CCNGG	2 cut(s)	22, 365
BstV1I	GCAGC	4 cut(s)	27, 58, 61, 429
BtsI	GCAGTG	1 cut(s)	459
BtsIMutI	CAGTG	3 cut(s)	65, 281, 459
BveI	ACCTGC	1 cut(s)	278
Cac8I	GCNNGC	3 cut(s)	184, 221, 295
CsiI	ACCWGGT	1 cut(s)	365
CviAII	CATG	7 cut(s)	91, 104, 197, 294, 360, 402, 433
CviJI	RGCY	8 cut(s)	40, 108, 154, 219, 243, 305, 386, 442
CviKI_1	RGCY	8 cut(s)	40, 108, 154, 219, 243, 305, 386, 442
DdeI	CTNAG	1 cut(s)	47
Eco31I	GGTCTC	1 cut(s)	100
EcoRI	GAATTC	1 cut(s)	158
EcoRII	CCWGG	2 cut(s)	22, 365
FaeI	CATG	7 cut(s)	94, 107, 200, 297, 363, 405, 436
FaiI	YATR	8 cut(s)	32, 92, 105, 198, 295, 361, 403, 434
FalI	AAGNNNNNCTT	2 cut(s)	203, 235
FatI	CATG	7 cut(s)	90, 103, 196, 293, 359, 401, 432
Fnu4HI	GCNGC	4 cut(s)	41, 72, 75, 443
Fsp4HI	GCNGC	4 cut(s)	41, 72, 75, 443
FspBI	CTAG	2 cut(s)	428, 446
GluI	GCNGC	4 cut(s)	41, 72, 75, 443
GsaI	CCCAGC	1 cut(s)	309
Hin1II	CATG	7 cut(s)	94, 107, 200, 297, 363, 405, 436
HinfI	GANTC	2 cut(s)	19, 226
HphI	GGTGA	1 cut(s)	277
Hpy188I	TCNGA	1 cut(s)	50
Hpy188III	TCNNGA	1 cut(s)	327
HpyCH4III	ACNGT	1 cut(s)	60
HpyCH4V	TGCA	6 cut(s)	125, 143, 223, 293, 363, 452
HpyF10VI	GCNNNNNNNGC	1 cut(s)	311
HpyF3I	CTNAG	1 cut(s)	47
Hsp92II	CATG	7 cut(s)	94, 107, 200, 297, 363, 405, 436
LmnI	GCTCC	3 cut(s)	48, 216, 350
LpnPI	CCDG	9 cut(s)	9, 36, 243, 247, 269, 273, 291, 352, 379
Lsp1109I	GCAGC	4 cut(s)	27, 58, 61, 429
LweI	GCATC	1 cut(s)	152
MabI	ACCWGGT	1 cut(s)	365
MaeI	CTAG	2 cut(s)	428, 446
MaeIII	GTNAC	2 cut(s)	265, 338
MluCI	AATT	3 cut(s)	51, 138, 158
MlyI	GAGTC	1 cut(s)	28
MmeI	TCCRAC	1 cut(s)	235
MnlI	CCTC	7 cut(s)	56, 127, 198, 207, 419, 422, 433
MseI	TTAA	1 cut(s)	137
MslI	CAYNNNNRTG	1 cut(s)	358
MspA1I	CMGCKG	1 cut(s)	305
MspR9I	CCNGG	2 cut(s)	24, 367
MvaI	CCWGG	2 cut(s)	24, 367
MwoI	GCNNNNNNNGC	1 cut(s)	311
NlaIII	CATG	7 cut(s)	94, 107, 200, 297, 363, 405, 436
NlaIV	GGNNCC	2 cut(s)	371, 407
NmuCI	GTSAC	1 cut(s)	265
NspI	RCATGY	1 cut(s)	297
PaeI	GCATGC	1 cut(s)	297
PaqCI	CACCTGC	1 cut(s)	278
PfeI	GAWTC	1 cut(s)	226
PfoI	TCCNGGA	1 cut(s)	22
PkrI	GCNGC	4 cut(s)	42, 73, 76, 444
PleI	GAGTC	1 cut(s)	27
PpsI	GAGTC	1 cut(s)	27
Psp6I	CCWGG	2 cut(s)	22, 365
PspFI	CCCAGC	1 cut(s)	305
PspGI	CCWGG	2 cut(s)	22, 365
PspN4I	GGNNCC	2 cut(s)	371, 407
PvuII	CAGCTG	1 cut(s)	305
RseI	CAYNNNNRTG	1 cut(s)	358
SaqAI	TTAA	1 cut(s)	137
SatI	GCNGC	4 cut(s)	41, 72, 75, 443
SchI	GAGTC	1 cut(s)	28
ScrFI	CCNGG	2 cut(s)	24, 367
SetI	ASST	8 cut(s)	9, 119, 209, 221, 292, 307, 371, 451
SexAI	ACCWGGT	1 cut(s)	365
SfaNI	GCATC	1 cut(s)	152
SmiMI	CAYNNNNRTG	1 cut(s)	358
SmlI	CTYRAG	1 cut(s)	325
SmoI	CTYRAG	1 cut(s)	325
SpeI	ACTAGT	1 cut(s)	427
SphI	GCATGC	1 cut(s)	297
Sse9I	AATT	3 cut(s)	51, 138, 158
SsiI	CCGC	1 cut(s)	314
SspMI	CTAG	2 cut(s)	428, 446
StyD4I	CCNGG	2 cut(s)	22, 365
TaaI	ACNGT	1 cut(s)	60
TasI	AATT	3 cut(s)	51, 138, 158
TfiI	GAWTC	1 cut(s)	226
Tru1I	TTAA	1 cut(s)	137
Tru9I	TTAA	1 cut(s)	137
TscAI	CASTG	3 cut(s)	65, 288, 459
TseFI	GTSAC	1 cut(s)	265
TseI	GCWGC	4 cut(s)	40, 71, 74, 442
Tsp45I	GTSAC	1 cut(s)	265
TspDTI	ATGAA	2 cut(s)	17, 185
TspRI	CASTG	3 cut(s)	65, 288, 459
XapI	RAATTY	1 cut(s)	158
XceI	RCATGY	1 cut(s)	297
XspI	CTAG	2 cut(s)	428, 446

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.