Rmu_sc0007829.1_g000004

Erwinia induced protein 2

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007829.1
Physical Location & Seq
Forward (+)
19598 .. 20234
637 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007829.1_g000004.1.cds

Sequence Viewer

Length: 426 bp
atgttctcagaggatgatttattacttgatccgacaccgtttgagaatgatggtaagattctagtggcagaggagatcgataatctcatggcctttggtgatgagtccttgaattctgatacaaataacccatcaattgatgatgcccatcttgagaaggagaaggaggaggagaagtggatggtgctaggctacggcactggcgtagaggccatgttggtcctcctcctcacactcattggcctcgactgcctccccaagggcctcatggtcgtcacgcaaaacctcctcaagcccttcctctcggtggtgcccttctgcctcttccttctcatggacatctactggaagtacgagaatcagccgaactgcgacaacgactcttgcaagccgttcgacacctctgccaccagaagtccatcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

141

Amino Acids

15.84

Weight (kDa)

4.05

Isoelectric Point (pI)

40.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 310
AclWI GGATC 1 cut(s) 23
AcsI RAATTY 1 cut(s) 112
AfaI GTAC 1 cut(s) 353
AfiI CCNNNNNNNGG 3 cut(s) 259, 307, 334
AgsI TTSAA 1 cut(s) 112
AlwI GGATC 1 cut(s) 23
AoxI GGCC 4 cut(s) 90, 210, 241, 262
ApoI RAATTY 1 cut(s) 112
AspS9I GGNCC 2 cut(s) 220, 262
AsuHPI GGTGA 1 cut(s) 110
AvaII GGWCC 1 cut(s) 220
BaeGI GKGCMC 1 cut(s) 315
BanI GGYRCC 1 cut(s) 310
BccI CCATC 4 cut(s) 44, 139, 156, 175
BceAI ACGGC 2 cut(s) 211, 376
BcgI CGANNNNNNTGC 4 cut(s) 376, 386, 410, 420
BfaI CTAG 2 cut(s) 62, 188
Bme18I GGWCC 1 cut(s) 220
BmgT120I GGNCC 2 cut(s) 220, 262
BmiI GGNNCC 1 cut(s) 312
BmsI GCATC 1 cut(s) 133
BpuEI CTTGAG 2 cut(s) 173, 275
Bsa29I ATCGAT 1 cut(s) 78
BsaBI GATNNNNATC 1 cut(s) 147
BsaJI CCNNGG 1 cut(s) 258
BsaXI ACNNNNNCTCC 2 cut(s) 161, 191
Bsc4I CCNNNNNNNGG 3 cut(s) 259, 307, 334
Bse1I ACTGG 2 cut(s) 205, 350
Bse8I GATNNNNATC 1 cut(s) 147
BseCI ATCGAT 1 cut(s) 78
BseDI CCNNGG 1 cut(s) 258
BseGI GGATG 2 cut(s) 19, 186
BseJI GATNNNNATC 1 cut(s) 147
BseLI CCNNNNNNNGG 3 cut(s) 259, 307, 334
BseMII CTCAG 1 cut(s) 21
BseNI ACTGG 2 cut(s) 205, 350
BseRI GAGGAG 6 cut(s) 86, 182, 185, 215, 218, 278
BseSI GKGCMC 1 cut(s) 315
BshFI GGCC 4 cut(s) 92, 212, 243, 264
BshNI GGYRCC 1 cut(s) 310
BshVI ATCGAT 1 cut(s) 78
BslI CCNNNNNNNGG 3 cut(s) 259, 307, 334
BsnI GGCC 4 cut(s) 92, 212, 243, 264
Bsp1286I GDGCHC 1 cut(s) 315
Bsp143I GATC 2 cut(s) 28, 75
BspANI GGCC 4 cut(s) 92, 212, 243, 264
BspCNI CTCAG 1 cut(s) 20
BspDI ATCGAT 1 cut(s) 78
BspHI TCATGA 1 cut(s) 422
BspLI GGNNCC 1 cut(s) 312
BspPI GGATC 1 cut(s) 23
BspT107I GGYRCC 1 cut(s) 310
BsrI ACTGG 2 cut(s) 205, 350
BssECI CCNNGG 1 cut(s) 258
BssMI GATC 2 cut(s) 28, 75
BssT1I CCWWGG 1 cut(s) 258
Bst4CI ACNGT 1 cut(s) 39
Bst6I CTCTTC 1 cut(s) 329
BstC8I GCNNGC 1 cut(s) 389
BstDEI CTNAG 1 cut(s) 7
BstENI CCTNNNNNAGG 1 cut(s) 257
BstF5I GGATG 2 cut(s) 19, 186
BstKTI GATC 2 cut(s) 31, 78
BstMBI GATC 2 cut(s) 28, 75
BstMWI GCNNNNNNNGC 1 cut(s) 249
BstSLI GKGCMC 1 cut(s) 315
Bsu15I ATCGAT 1 cut(s) 78
BsuRI GGCC 4 cut(s) 92, 212, 243, 264
BsuTUI ATCGAT 1 cut(s) 78
BtsCI GGATG 2 cut(s) 19, 186
BtsIMutI CAGTG 1 cut(s) 198
Cac8I GCNNGC 1 cut(s) 389
CciI TCATGA 1 cut(s) 422
Cfr13I GGNCC 2 cut(s) 220, 262
ClaI ATCGAT 1 cut(s) 78
Csp6I GTAC 1 cut(s) 352
CviAII CATG 5 cut(s) 88, 214, 268, 334, 423
CviJI RGCY 8 cut(s) 92, 192, 212, 243, 264, 295, 364, 391
CviKI_1 RGCY 8 cut(s) 92, 192, 212, 243, 264, 295, 364, 391
CviQI GTAC 1 cut(s) 352
DdeI CTNAG 1 cut(s) 7
DpnI GATC 2 cut(s) 30, 77
DpnII GATC 2 cut(s) 28, 75
Eam1104I CTCTTC 1 cut(s) 329
EarI CTCTTC 1 cut(s) 329
Eco130I CCWWGG 1 cut(s) 258
Eco47I GGWCC 1 cut(s) 220
EcoNI CCTNNNNNAGG 1 cut(s) 257
EcoO109I RGGNCCY 1 cut(s) 262
EcoRI GAATTC 1 cut(s) 112
EcoT14I CCWWGG 1 cut(s) 258
ErhI CCWWGG 1 cut(s) 258
FaeI CATG 5 cut(s) 91, 217, 271, 337, 426
FaiI YATR 5 cut(s) 89, 215, 269, 335, 424
FatI CATG 5 cut(s) 87, 213, 267, 333, 422
FokI GGATG 2 cut(s) 26, 193
FspBI CTAG 2 cut(s) 62, 188
HaeIII GGCC 4 cut(s) 92, 212, 243, 264
Hin1II CATG 5 cut(s) 91, 217, 271, 337, 426
HinfI GANTC 4 cut(s) 58, 104, 358, 380
HphI GGTGA 1 cut(s) 110
Hpy188I TCNGA 3 cut(s) 10, 33, 118
Hpy188III TCNNGA 2 cut(s) 152, 423
HpyAV CCTTC 5 cut(s) 151, 157, 307, 325, 338
HpyCH4III ACNGT 1 cut(s) 39
HpyCH4V TGCA 1 cut(s) 387
HpyF10VI GCNNNNNNNGC 1 cut(s) 249
HpyF3I CTNAG 1 cut(s) 7
Hsp92II CATG 5 cut(s) 91, 217, 271, 337, 426
Kzo9I GATC 2 cut(s) 28, 75
LpnPI CCDG 2 cut(s) 186, 331
LweI GCATC 1 cut(s) 133
MaeI CTAG 2 cut(s) 62, 188
MaeIII GTNAC 1 cut(s) 274
MalI GATC 2 cut(s) 30, 77
MboI GATC 2 cut(s) 28, 75
MboII GAAGA 1 cut(s) 316
MfeI CAATTG 1 cut(s) 135
MhlI GDGCHC 1 cut(s) 315
MluCI AATT 2 cut(s) 112, 135
MlyI GAGTC 2 cut(s) 113, 374
MmeI TCCRAC 1 cut(s) 56
MunI CAATTG 1 cut(s) 135
MwoI GCNNNNNNNGC 1 cut(s) 249
NdeII GATC 2 cut(s) 28, 75
NlaIII CATG 5 cut(s) 91, 217, 271, 337, 426
NlaIV GGNNCC 1 cut(s) 312
NmuCI GTSAC 1 cut(s) 274
PagI TCATGA 1 cut(s) 422
PcsI WCGNNNNNNNCGW 1 cut(s) 201
PfeI GAWTC 2 cut(s) 58, 358
PleI GAGTC 2 cut(s) 112, 374
PpsI GAGTC 2 cut(s) 112, 374
PspN4I GGNNCC 1 cut(s) 312
PspPI GGNCC 2 cut(s) 220, 262
RsaI GTAC 1 cut(s) 353
RsaNI GTAC 1 cut(s) 352
Sau3AI GATC 2 cut(s) 28, 75
Sau96I GGNCC 2 cut(s) 220, 262
SchI GAGTC 2 cut(s) 113, 374
SduI GDGCHC 1 cut(s) 315
SetI ASST 2 cut(s) 288, 404
SfaNI GCATC 1 cut(s) 133
SinI GGWCC 1 cut(s) 220
SmlI CTYRAG 2 cut(s) 152, 290
SmoI CTYRAG 2 cut(s) 152, 290
Sse9I AATT 2 cut(s) 112, 135
SspMI CTAG 2 cut(s) 62, 188
StyI CCWWGG 1 cut(s) 258
TaaI ACNGT 1 cut(s) 39
TaqI TCGA 3 cut(s) 78, 246, 396
TasI AATT 2 cut(s) 112, 135
TfiI GAWTC 2 cut(s) 58, 358
TscAI CASTG 1 cut(s) 205
TseFI GTSAC 1 cut(s) 274
Tsp45I GTSAC 1 cut(s) 274
TspRI CASTG 1 cut(s) 205
VpaK11BI GGWCC 1 cut(s) 220
XagI CCTNNNNNAGG 1 cut(s) 257
XapI RAATTY 1 cut(s) 112
XcmI CCANNNNNNNNNTGG 1 cut(s) 265
XspI CTAG 2 cut(s) 62, 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.