Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007885.1

Orthogroup ID

OG0004480

Physical Location & Seq

Genomic Coordinates Reverse (-)

70628 .. 72002

Gene Structure 1375 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007885.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 264 bp

atgtctagcagatggatcaggcccgaggtgtacccactctttgcagcaactggtgtagctgttagtatctgtgcaatgcaactggttagaaacatcacgagcaaccctgaagtgagggttttaaaggagaacagagctgctggaattctagacaactttgaagagggtgagaaatacaaagaacatggacttaggaagtttgttcgcaagagaaaccccgagatcatgccatccatcaacaaatttttctcagacccaaactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B12D

Protein Analysis

87

Amino Acids

10.01

Weight (kDa)

9.57

Isoelectric Point (pI)

57.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004480)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G48140
fragaria_vesca	FvH4_4g24540 FvH4_4g24540 FvH4_5g16300
malus_domestica	MD06G1182100.v1.1 MD13G1111000.v1.1 MD13G1111400.v1.1 MD14G1188100.v1.1 MD16G1111000.v1.1
prunus_persica	Prupe.1G234100_v2.0.a1 Prupe.5G180300_v2.0.a1
pyrus_communis	pycom06g16110 pycom14g15580
rosa_chinensis	RchiOBHm_Chr4g0431281 RchiOBHm_Chr7g0179831
rosa_multiflora	Rmu_sc0001754.1_g000004 Rmu_sc0002637.1_g000009 Rmu_sc0004156.1_g000011 Rmu_sc0007885.1_g000013
rosa_roxburghii	Rroxscaffold_3G00273430 Rroxscaffold_5G00372830
rosa_rugosa	Rorug04G0250000 Rorug06G0428600
rosa_samantha	Rh4AG305800 Rh4BG313200 Rh4CG329400 Rh4DG309600 Rh7AG028400 Rh7BG027300 Rh7CG029300
rosa_wichuraiana	Rw4G026590 Rw7G002270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	23
AcsI	RAATTY	2 cut(s)	144, 242
AcuI	CTGAAG	1 cut(s)	129
AfaI	GTAC	1 cut(s)	32
AgsI	TTSAA	1 cut(s)	161
AluBI	AGCT	2 cut(s)	59, 137
AluI	AGCT	2 cut(s)	59, 137
AlwI	GGATC	1 cut(s)	23
AlwNI	CAGNNNCTG	1 cut(s)	50
Ama87I	CYCGRG	2 cut(s)	23, 218
AoxI	GGCC	1 cut(s)	20
ApeKI	GCWGC	2 cut(s)	44, 137
ApoI	RAATTY	2 cut(s)	144, 242
AspS9I	GGNCC	1 cut(s)	21
AsuHPI	GGTGA	1 cut(s)	179
AvaI	CYCGRG	2 cut(s)	23, 218
BauI	CACGAG	1 cut(s)	97
BbvI	GCAGC	2 cut(s)	56, 124
BccI	CCATC	3 cut(s)	6, 238, 242
BfaI	CTAG	2 cut(s)	6, 149
BisI	GCNGC	2 cut(s)	45, 138
BlsI	GCNGC	2 cut(s)	46, 139
BmeT110I	CYCGRG	2 cut(s)	23, 218
BmgT120I	GGNCC	1 cut(s)	21
BsaJI	CCNNGG	1 cut(s)	24
Bse1I	ACTGG	2 cut(s)	55, 87
Bse3DI	GCAATG	1 cut(s)	81
BseDI	CCNNGG	1 cut(s)	24
BseGI	GGATG	1 cut(s)	230
BseMI	GCAATG	1 cut(s)	81
BseMII	CTCAG	1 cut(s)	264
BseNI	ACTGG	2 cut(s)	55, 87
BseXI	GCAGC	2 cut(s)	56, 124
BshFI	GGCC	1 cut(s)	22
BsiHKCI	CYCGRG	2 cut(s)	23, 218
BsnI	GGCC	1 cut(s)	22
BsoBI	CYCGRG	2 cut(s)	23, 218
Bsp143I	GATC	2 cut(s)	15, 222
BspANI	GGCC	1 cut(s)	22
BspCNI	CTCAG	1 cut(s)	263
BspPI	GGATC	1 cut(s)	23
BsrDI	GCAATG	1 cut(s)	81
BsrI	ACTGG	2 cut(s)	55, 87
BssECI	CCNNGG	1 cut(s)	24
BssMI	GATC	2 cut(s)	15, 222
BssSI	CACGAG	1 cut(s)	97
Bst2BI	CACGAG	1 cut(s)	97
Bst6I	CTCTTC	1 cut(s)	156
BstDEI	CTNAG	2 cut(s)	191, 250
BstF5I	GGATG	1 cut(s)	230
BstKTI	GATC	2 cut(s)	18, 225
BstMBI	GATC	2 cut(s)	15, 222
BstV1I	GCAGC	2 cut(s)	56, 124
BsuRI	GGCC	1 cut(s)	22
BtsCI	GGATG	1 cut(s)	230
CaiI	CAGNNNCTG	1 cut(s)	50
Cfr13I	GGNCC	1 cut(s)	21
Csp6I	GTAC	1 cut(s)	31
CviAII	CATG	2 cut(s)	185, 226
CviJI	RGCY	3 cut(s)	22, 59, 137
CviKI_1	RGCY	3 cut(s)	22, 59, 137
CviQI	GTAC	1 cut(s)	31
DdeI	CTNAG	2 cut(s)	191, 250
DpnI	GATC	2 cut(s)	17, 224
DpnII	GATC	2 cut(s)	15, 222
DraI	TTTAAA	1 cut(s)	123
Eam1104I	CTCTTC	1 cut(s)	156
EarI	CTCTTC	1 cut(s)	156
Eco57I	CTGAAG	1 cut(s)	129
Eco88I	CYCGRG	2 cut(s)	23, 218
EcoRI	GAATTC	1 cut(s)	144
FaeI	CATG	2 cut(s)	188, 229
FaiI	YATR	2 cut(s)	186, 227
FatI	CATG	2 cut(s)	184, 225
Fnu4HI	GCNGC	2 cut(s)	45, 138
FokI	GGATG	1 cut(s)	217
Fsp4HI	GCNGC	2 cut(s)	45, 138
FspBI	CTAG	2 cut(s)	6, 149
GluI	GCNGC	2 cut(s)	45, 138
HaeIII	GGCC	1 cut(s)	22
Hin1II	CATG	2 cut(s)	188, 229
HphI	GGTGA	1 cut(s)	179
Hpy166II	GTNNAC	1 cut(s)	31
Hpy188I	TCNGA	1 cut(s)	253
Hpy188III	TCNNGA	2 cut(s)	97, 149
Hpy8I	GTNNAC	1 cut(s)	31
HpyCH4V	TGCA	3 cut(s)	44, 74, 79
HpyF3I	CTNAG	2 cut(s)	191, 250
Hsp92II	CATG	2 cut(s)	188, 229
Kzo9I	GATC	2 cut(s)	15, 222
LpnPI	CCDG	5 cut(s)	4, 36, 68, 120, 126
Lsp1109I	GCAGC	2 cut(s)	56, 124
MaeI	CTAG	2 cut(s)	6, 149
MalI	GATC	2 cut(s)	17, 224
MboI	GATC	2 cut(s)	15, 222
MboII	GAAGA	1 cut(s)	173
MluCI	AATT	2 cut(s)	144, 242
MnlI	CCTC	3 cut(s)	19, 108, 157
MseI	TTAA	1 cut(s)	122
NdeII	GATC	2 cut(s)	15, 222
NlaIII	CATG	2 cut(s)	188, 229
PkrI	GCNGC	2 cut(s)	46, 139
PspPI	GGNCC	1 cut(s)	21
PstNI	CAGNNNCTG	1 cut(s)	50
RsaI	GTAC	1 cut(s)	32
RsaNI	GTAC	1 cut(s)	31
SaqAI	TTAA	1 cut(s)	122
SatI	GCNGC	2 cut(s)	45, 138
Sau3AI	GATC	2 cut(s)	15, 222
Sau96I	GGNCC	1 cut(s)	21
SetI	ASST	3 cut(s)	30, 61, 139
Sse9I	AATT	2 cut(s)	144, 242
SspMI	CTAG	2 cut(s)	6, 149
TasI	AATT	2 cut(s)	144, 242
Tru1I	TTAA	1 cut(s)	122
Tru9I	TTAA	1 cut(s)	122
TseI	GCWGC	2 cut(s)	44, 137
XapI	RAATTY	2 cut(s)	144, 242
XbaI	TCTAGA	1 cut(s)	148
XspI	CTAG	2 cut(s)	6, 149

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.