Rroxscaffold_5G00372830

NADH-ubiquinone reductase complex 1 MLRQ subunit

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
54151606 .. 54153326
1721 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00372830.1

Sequence Viewer

Length: 264 bp
ATGTCTAGCAGATGGATCAGGCCCGAGGTGTATCCACTCTTTGCAGCAACTGGTGTAGCTGTTGGTATCTGTGCAATGCAACTCGTTAGAAACATCACGAGCAACCCTGAAGTGAGGGTTTTAAAGGAGAATAGAGCTGCTGGAATTCTAGAAAACTTTGAAGAGGGTGAGAAATACAAAGAACATGGACTTAGGAAGTTTGTTCGCAAGAGAAACCCCGAGATCATGCCATCCATCAACAAATTTTTCTCAGACCCAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.99

Weight (kDa)

9.57

Isoelectric Point (pI)

55.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B12D PF06522 5 - 59 5.1e-23 NADH-ubiquinone reductase complex 1 MLRQ subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 23
AcsI RAATTY 2 cut(s) 144, 242
AcuI CTGAAG 1 cut(s) 129
AgsI TTSAA 1 cut(s) 161
AluBI AGCT 2 cut(s) 59, 137
AluI AGCT 2 cut(s) 59, 137
AlwI GGATC 1 cut(s) 23
AlwNI CAGNNNCTG 1 cut(s) 50
Ama87I CYCGRG 2 cut(s) 23, 218
AoxI GGCC 1 cut(s) 20
ApeKI GCWGC 2 cut(s) 44, 137
ApoI RAATTY 2 cut(s) 144, 242
AspS9I GGNCC 1 cut(s) 21
AsuHPI GGTGA 1 cut(s) 179
AvaI CYCGRG 2 cut(s) 23, 218
BauI CACGAG 1 cut(s) 97
BbvI GCAGC 2 cut(s) 56, 124
BccI CCATC 3 cut(s) 6, 238, 242
BciVI GTATCC 1 cut(s) 42
BfaI CTAG 2 cut(s) 6, 149
BfuI GTATCC 1 cut(s) 42
BisI GCNGC 2 cut(s) 45, 138
BlsI GCNGC 2 cut(s) 46, 139
BmeT110I CYCGRG 2 cut(s) 23, 218
BmgT120I GGNCC 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 55
Bse3DI GCAATG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 24
BseGI GGATG 1 cut(s) 230
BseMI GCAATG 1 cut(s) 81
BseMII CTCAG 1 cut(s) 264
BseNI ACTGG 1 cut(s) 55
BseXI GCAGC 2 cut(s) 56, 124
BshFI GGCC 1 cut(s) 22
BsiHKCI CYCGRG 2 cut(s) 23, 218
BsnI GGCC 1 cut(s) 22
BsoBI CYCGRG 2 cut(s) 23, 218
Bsp143I GATC 2 cut(s) 15, 222
BspANI GGCC 1 cut(s) 22
BspCNI CTCAG 1 cut(s) 263
BspPI GGATC 1 cut(s) 23
BsrDI GCAATG 1 cut(s) 81
BsrI ACTGG 1 cut(s) 55
BssECI CCNNGG 1 cut(s) 24
BssMI GATC 2 cut(s) 15, 222
BssSI CACGAG 1 cut(s) 97
Bst2BI CACGAG 1 cut(s) 97
Bst6I CTCTTC 1 cut(s) 156
BstDEI CTNAG 2 cut(s) 191, 250
BstF5I GGATG 1 cut(s) 230
BstKTI GATC 2 cut(s) 18, 225
BstMBI GATC 2 cut(s) 15, 222
BstV1I GCAGC 2 cut(s) 56, 124
BsuI GTATCC 1 cut(s) 42
BsuRI GGCC 1 cut(s) 22
BtsCI GGATG 1 cut(s) 230
CaiI CAGNNNCTG 1 cut(s) 50
Cfr13I GGNCC 1 cut(s) 21
CviAII CATG 2 cut(s) 185, 226
CviJI RGCY 3 cut(s) 22, 59, 137
CviKI_1 RGCY 3 cut(s) 22, 59, 137
DdeI CTNAG 2 cut(s) 191, 250
DpnI GATC 2 cut(s) 17, 224
DpnII GATC 2 cut(s) 15, 222
DraI TTTAAA 1 cut(s) 123
Eam1104I CTCTTC 1 cut(s) 156
EarI CTCTTC 1 cut(s) 156
Eco57I CTGAAG 1 cut(s) 129
Eco88I CYCGRG 2 cut(s) 23, 218
EcoRI GAATTC 1 cut(s) 144
FaeI CATG 2 cut(s) 188, 229
FaiI YATR 2 cut(s) 186, 227
FatI CATG 2 cut(s) 184, 225
Fnu4HI GCNGC 2 cut(s) 45, 138
FokI GGATG 1 cut(s) 217
Fsp4HI GCNGC 2 cut(s) 45, 138
FspBI CTAG 2 cut(s) 6, 149
GluI GCNGC 2 cut(s) 45, 138
HaeIII GGCC 1 cut(s) 22
Hin1II CATG 2 cut(s) 188, 229
HphI GGTGA 1 cut(s) 179
Hpy188I TCNGA 1 cut(s) 253
Hpy188III TCNNGA 2 cut(s) 97, 149
HpyCH4V TGCA 3 cut(s) 44, 74, 79
HpyF3I CTNAG 2 cut(s) 191, 250
Hsp92II CATG 2 cut(s) 188, 229
Kzo9I GATC 2 cut(s) 15, 222
LpnPI CCDG 4 cut(s) 4, 36, 120, 126
Lsp1109I GCAGC 2 cut(s) 56, 124
MaeI CTAG 2 cut(s) 6, 149
MalI GATC 2 cut(s) 17, 224
MboI GATC 2 cut(s) 15, 222
MboII GAAGA 1 cut(s) 173
MluCI AATT 2 cut(s) 144, 242
MnlI CCTC 3 cut(s) 19, 108, 157
MseI TTAA 1 cut(s) 122
NdeII GATC 2 cut(s) 15, 222
NlaIII CATG 2 cut(s) 188, 229
PkrI GCNGC 2 cut(s) 46, 139
PspPI GGNCC 1 cut(s) 21
PstNI CAGNNNCTG 1 cut(s) 50
SaqAI TTAA 1 cut(s) 122
SatI GCNGC 2 cut(s) 45, 138
Sau3AI GATC 2 cut(s) 15, 222
Sau96I GGNCC 1 cut(s) 21
SetI ASST 3 cut(s) 30, 61, 139
Sse9I AATT 2 cut(s) 144, 242
SspMI CTAG 2 cut(s) 6, 149
TasI AATT 2 cut(s) 144, 242
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TseI GCWGC 2 cut(s) 44, 137
XapI RAATTY 2 cut(s) 144, 242
XbaI TCTAGA 1 cut(s) 148
XspI CTAG 2 cut(s) 6, 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.