Rh4BG313200

NADH-ubiquinone reductase complex 1 MLRQ subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
48100996 .. 48103595
2600 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG313200.1

Sequence Viewer

Length: 189 bp
ATGCAACTCGTTAGAAACATCACGAGCAACCCTGAAGTGAGGGTTTTAAAGGAGAACAGAGCTGCTGGAATTCTAGACAACTTTGAAGAGGGTGAGAAATACAAAGAACATGGACTTAGGAAGTTTGTTCGCAAGAGAAACCCCGAGATCATGCCATCCATCAACAAATTTTTCTCAGACCCAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.3

Weight (kDa)

9.6

Isoelectric Point (pI)

48.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B12D PF06522 1 - 34 2.2e-09 NADH-ubiquinone reductase complex 1 MLRQ subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 69, 167
AcuI CTGAAG 1 cut(s) 54
AgsI TTSAA 1 cut(s) 86
AluBI AGCT 1 cut(s) 62
AluI AGCT 1 cut(s) 62
Ama87I CYCGRG 1 cut(s) 143
ApeKI GCWGC 1 cut(s) 62
ApoI RAATTY 2 cut(s) 69, 167
AsuHPI GGTGA 1 cut(s) 104
AvaI CYCGRG 1 cut(s) 143
BauI CACGAG 1 cut(s) 22
BbvI GCAGC 1 cut(s) 49
BccI CCATC 2 cut(s) 163, 167
BfaI CTAG 1 cut(s) 74
BisI GCNGC 1 cut(s) 63
BlsI GCNGC 1 cut(s) 64
BmeT110I CYCGRG 1 cut(s) 143
BseGI GGATG 1 cut(s) 155
BseMII CTCAG 1 cut(s) 189
BseXI GCAGC 1 cut(s) 49
BsiHKCI CYCGRG 1 cut(s) 143
BsoBI CYCGRG 1 cut(s) 143
Bsp143I GATC 1 cut(s) 147
BspCNI CTCAG 1 cut(s) 188
BssMI GATC 1 cut(s) 147
BssSI CACGAG 1 cut(s) 22
Bst2BI CACGAG 1 cut(s) 22
Bst6I CTCTTC 1 cut(s) 81
BstDEI CTNAG 2 cut(s) 116, 175
BstF5I GGATG 1 cut(s) 155
BstKTI GATC 1 cut(s) 150
BstMBI GATC 1 cut(s) 147
BstV1I GCAGC 1 cut(s) 49
BtsCI GGATG 1 cut(s) 155
CviAII CATG 2 cut(s) 110, 151
CviJI RGCY 1 cut(s) 62
CviKI_1 RGCY 1 cut(s) 62
DdeI CTNAG 2 cut(s) 116, 175
DpnI GATC 1 cut(s) 149
DpnII GATC 1 cut(s) 147
DraI TTTAAA 1 cut(s) 48
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 54
Eco88I CYCGRG 1 cut(s) 143
EcoRI GAATTC 1 cut(s) 69
FaeI CATG 2 cut(s) 113, 154
FaiI YATR 2 cut(s) 111, 152
FatI CATG 2 cut(s) 109, 150
Fnu4HI GCNGC 1 cut(s) 63
FokI GGATG 1 cut(s) 142
Fsp4HI GCNGC 1 cut(s) 63
FspBI CTAG 1 cut(s) 74
GluI GCNGC 1 cut(s) 63
Hin1II CATG 2 cut(s) 113, 154
HphI GGTGA 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 178
Hpy188III TCNNGA 2 cut(s) 22, 74
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 2 cut(s) 116, 175
Hsp92II CATG 2 cut(s) 113, 154
Kzo9I GATC 1 cut(s) 147
LpnPI CCDG 2 cut(s) 45, 51
Lsp1109I GCAGC 1 cut(s) 49
MaeI CTAG 1 cut(s) 74
MalI GATC 1 cut(s) 149
MboI GATC 1 cut(s) 147
MboII GAAGA 1 cut(s) 98
MluCI AATT 2 cut(s) 69, 167
MnlI CCTC 2 cut(s) 33, 82
MseI TTAA 1 cut(s) 47
NdeII GATC 1 cut(s) 147
NlaIII CATG 2 cut(s) 113, 154
PkrI GCNGC 1 cut(s) 64
SaqAI TTAA 1 cut(s) 47
SatI GCNGC 1 cut(s) 63
Sau3AI GATC 1 cut(s) 147
SetI ASST 1 cut(s) 64
Sse9I AATT 2 cut(s) 69, 167
SspMI CTAG 1 cut(s) 74
TasI AATT 2 cut(s) 69, 167
Tru1I TTAA 1 cut(s) 47
Tru9I TTAA 1 cut(s) 47
TseI GCWGC 1 cut(s) 62
XapI RAATTY 2 cut(s) 69, 167
XbaI TCTAGA 1 cut(s) 73
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.