Rmu_sc0008574.1_g000001

Catalyzes the reversible reaction in which hydroxymethyl group from 5,10-methylenetetrahydrofolate is transferred onto alpha-ketoisovalerate to form ketopantoate

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008574.1
Physical Location & Seq
Forward (+)
13 .. 396
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008574.1_g000001.1.cds

Sequence Viewer

Length: 294 bp
atgcaggtgctagtttaccatgatcttcttggaatgatgcagcacccacgtcatgcaaaggttaccccaaaattctgtaagcaatatgcacatgttggaaaagtcatcaacaaagctctagtagactacaaggaagaagtcaccaatggtgcgtttccaggcgctttccatagcccatataaaatcaatgctgctgatgttgatggctttgttagtgagttaggaaggatgggtttggacaaggcagcatctgcggcggctgaagtagctgacaagaataatacaagcaaatga

Protein Analysis

97

Amino Acids

10.59

Weight (kDa)

8.71

Isoelectric Point (pI)

7.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 123
AciI CCGC 2 cut(s) 254, 257
AcsI RAATTY 1 cut(s) 71
AcuI CTGAAG 1 cut(s) 282
AflIII ACRYGT 1 cut(s) 91
AjiI CACGTC 1 cut(s) 50
AjnI CCWGG 1 cut(s) 157
AluBI AGCT 2 cut(s) 116, 269
AluI AGCT 2 cut(s) 116, 269
AlwNI CAGNNNCTG 1 cut(s) 251
ApeKI GCWGC 3 cut(s) 40, 191, 245
ApoI RAATTY 1 cut(s) 71
AspLEI GCGC 1 cut(s) 164
AsuHPI GGTGA 1 cut(s) 133
BbvI GCAGC 3 cut(s) 52, 178, 257
BccI CCATC 2 cut(s) 197, 223
BciT130I CCWGG 1 cut(s) 159
BfaI CTAG 2 cut(s) 11, 119
BfoI RGCGCY 1 cut(s) 165
BisI GCNGC 5 cut(s) 41, 192, 246, 255, 258
BlsI GCNGC 5 cut(s) 42, 193, 247, 256, 259
Bme1390I CCNGG 1 cut(s) 159
BmgBI CACGTC 1 cut(s) 50
BmrFI CCNGG 1 cut(s) 159
BmsI GCATC 2 cut(s) 27, 257
BseBI CCWGG 1 cut(s) 159
BseGI GGATG 1 cut(s) 234
BseXI GCAGC 3 cut(s) 52, 178, 257
Bsp143I GATC 1 cut(s) 22
BspACI CCGC 2 cut(s) 254, 257
BssMI GATC 1 cut(s) 22
Bst2UI CCWGG 1 cut(s) 159
BstAPI GCANNNNNTGC 1 cut(s) 251
BstEII GGTNACC 1 cut(s) 61
BstF5I GGATG 1 cut(s) 234
BstH2I RGCGCY 1 cut(s) 165
BstHHI GCGC 1 cut(s) 164
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BstMWI GCNNNNNNNGC 3 cut(s) 251, 254, 266
BstNI CCWGG 1 cut(s) 159
BstNSI RCATGY 1 cut(s) 95
BstPI GGTNACC 1 cut(s) 61
BstSCI CCNGG 1 cut(s) 157
BstV1I GCAGC 3 cut(s) 52, 178, 257
BtrI CACGTC 1 cut(s) 50
BtsCI GGATG 1 cut(s) 234
CaiI CAGNNNCTG 1 cut(s) 251
CfoI GCGC 1 cut(s) 164
CviAII CATG 3 cut(s) 20, 53, 92
CviJI RGCY 5 cut(s) 116, 174, 207, 260, 269
CviKI_1 RGCY 5 cut(s) 116, 174, 207, 260, 269
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
Eco57I CTGAAG 1 cut(s) 282
Eco91I GGTNACC 1 cut(s) 61
EcoO65I GGTNACC 1 cut(s) 61
EcoRII CCWGG 1 cut(s) 157
FaeI CATG 3 cut(s) 23, 56, 95
FaiI YATR 7 cut(s) 21, 54, 87, 93, 171, 178, 180
FatI CATG 3 cut(s) 19, 52, 91
FblI GTMKAC 1 cut(s) 123
Fnu4HI GCNGC 5 cut(s) 41, 192, 246, 255, 258
FokI GGATG 1 cut(s) 241
Fsp4HI GCNGC 5 cut(s) 41, 192, 246, 255, 258
FspBI CTAG 2 cut(s) 11, 119
GlaI GCGC 1 cut(s) 163
GluI GCNGC 5 cut(s) 41, 192, 246, 255, 258
HaeII RGCGCY 1 cut(s) 165
HhaI GCGC 1 cut(s) 164
Hin1II CATG 3 cut(s) 23, 56, 95
Hin6I GCGC 1 cut(s) 162
HinP1I GCGC 1 cut(s) 162
HphI GGTGA 1 cut(s) 133
Hpy166II GTNNAC 2 cut(s) 16, 124
Hpy8I GTNNAC 2 cut(s) 16, 124
HpyAV CCTTC 1 cut(s) 219
HpyCH4IV ACGT 1 cut(s) 49
HpyCH4V TGCA 4 cut(s) 4, 40, 56, 89
HpyF10VI GCNNNNNNNGC 3 cut(s) 251, 254, 266
HpySE526I ACGT 1 cut(s) 49
Hsp92II CATG 3 cut(s) 23, 56, 95
HspAI GCGC 1 cut(s) 162
Kzo9I GATC 1 cut(s) 22
LpnPI CCDG 2 cut(s) 144, 171
Lsp1109I GCAGC 3 cut(s) 52, 178, 257
LweI GCATC 2 cut(s) 27, 257
MaeI CTAG 2 cut(s) 11, 119
MaeII ACGT 1 cut(s) 49
MaeIII GTNAC 2 cut(s) 61, 139
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MboII GAAGA 2 cut(s) 17, 146
MluCI AATT 1 cut(s) 71
MmeI TCCRAC 1 cut(s) 76
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
MwoI GCNNNNNNNGC 3 cut(s) 251, 254, 266
NdeII GATC 1 cut(s) 22
NlaIII CATG 3 cut(s) 23, 56, 95
NmuCI GTSAC 1 cut(s) 139
NspI RCATGY 1 cut(s) 95
PciI ACATGT 1 cut(s) 91
PkrI GCNGC 5 cut(s) 42, 193, 247, 256, 259
PscI ACATGT 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 157
PspEI GGTNACC 1 cut(s) 61
PspGI CCWGG 1 cut(s) 157
PstNI CAGNNNCTG 1 cut(s) 251
SatI GCNGC 5 cut(s) 41, 192, 246, 255, 258
Sau3AI GATC 1 cut(s) 22
ScrFI CCNGG 1 cut(s) 159
SetI ASST 5 cut(s) 9, 52, 63, 118, 271
SfaNI GCATC 2 cut(s) 27, 257
Sse9I AATT 1 cut(s) 71
SsiI CCGC 2 cut(s) 254, 257
SspMI CTAG 2 cut(s) 11, 119
StyD4I CCNGG 1 cut(s) 157
TaiI ACGT 1 cut(s) 52
TasI AATT 1 cut(s) 71
TauI GCSGC 2 cut(s) 257, 260
TseFI GTSAC 1 cut(s) 139
TseI GCWGC 3 cut(s) 40, 191, 245
Tsp45I GTSAC 1 cut(s) 139
XapI RAATTY 1 cut(s) 71
XceI RCATGY 1 cut(s) 95
XcmI CCANNNNNNNNNTGG 1 cut(s) 26
XmiI GTMKAC 1 cut(s) 123
XspI CTAG 2 cut(s) 11, 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.