Rmu_sc0009290.1_g000004

Cytochrome c oxidase is the component of the respiratory chain that catalyzes the reduction of oxygen to water. Subunits 1- 3 form the functional core of the enzyme complex. CO I is the catalytic subunit of the enzyme. Electrons originating in cytochrome c are transferred via the copper A center of subunit 2 and heme A of subunit 1 to the bimetallic center formed by heme A3 and copper B

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009290.1
OG0005840
Physical Location & Seq
Forward (+)
31022 .. 31378
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009290.1_g000004.1.cds

Sequence Viewer

Length: 357 bp
atggggatggggatcaaaataccatccccaccccgtacccgatttcagaattcgaatactggggatccccttccccgttacccgatttcccccaaatttctccccattagggtcgaatacccgatgggtaccctatggggattattgccatccctaatcccgctggtgggggggaagccccatattataccagcatctctcttttggttttttggtcatccagaggtgattctcattctgcctggattcggtatcataagtcatatcttttggaccatctcctcagccatagctttggtcggggccatagtcataaaaggaatccttcaaccagctcaatggaacgctccaacttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00190 ko01100 map00190 map01100
Pfam Domains
Protein Families
COX1

Protein Analysis

118

Amino Acids

12.9

Weight (kDa)

10.28

Isoelectric Point (pI)

42.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 128
AccB1I GGYRCC 1 cut(s) 128
AciI CCGC 1 cut(s) 161
AclWI GGATC 3 cut(s) 20, 59, 72
AcsI RAATTY 2 cut(s) 49, 95
AfaI GTAC 2 cut(s) 37, 130
AfiI CCNNNNNNNGG 4 cut(s) 109, 166, 167, 248
AgsI TTSAA 1 cut(s) 329
AjnI CCWGG 1 cut(s) 241
AluBI AGCT 2 cut(s) 293, 335
AluI AGCT 2 cut(s) 293, 335
AlwI GGATC 3 cut(s) 20, 59, 72
AoxI GGCC 1 cut(s) 303
ApoI RAATTY 2 cut(s) 49, 95
Asp718I GGTACC 1 cut(s) 128
AspS9I GGNCC 2 cut(s) 273, 303
AsuHPI GGTGA 1 cut(s) 238
AsuII TTCGAA 1 cut(s) 53
AvaII GGWCC 1 cut(s) 273
BamHI GGATCC 1 cut(s) 64
BanI GGYRCC 1 cut(s) 128
BbvCI CCTCAGC 1 cut(s) 283
BccI CCATC 4 cut(s) 31, 118, 157, 284
BciT130I CCWGG 1 cut(s) 243
Bme1390I CCNGG 1 cut(s) 243
Bme18I GGWCC 1 cut(s) 273
BmgT120I GGNCC 2 cut(s) 273, 303
BmiI GGNNCC 3 cut(s) 66, 130, 304
BmrFI CCNGG 1 cut(s) 243
BmrI ACTGGG 1 cut(s) 69
BmsI GCATC 1 cut(s) 203
BmuI ACTGGG 1 cut(s) 69
Bpu10I CCTNAGC 1 cut(s) 283
Bpu14I TTCGAA 1 cut(s) 53
BsaBI GATNNNNATC 1 cut(s) 11
Bsc4I CCNNNNNNNGG 4 cut(s) 109, 166, 167, 248
Bse1I ACTGG 1 cut(s) 64
Bse8I GATNNNNATC 1 cut(s) 11
BseBI CCWGG 1 cut(s) 243
BseGI GGATG 4 cut(s) 12, 23, 149, 217
BseJI GATNNNNATC 1 cut(s) 11
BseLI CCNNNNNNNGG 4 cut(s) 109, 166, 167, 248
BseMII CTCAG 1 cut(s) 297
BseNI ACTGG 1 cut(s) 64
BseRI GAGGAG 1 cut(s) 271
BshFI GGCC 1 cut(s) 305
BshNI GGYRCC 1 cut(s) 128
BslI CCNNNNNNNGG 4 cut(s) 109, 166, 167, 248
BsnI GGCC 1 cut(s) 305
Bsp119I TTCGAA 1 cut(s) 53
Bsp143I GATC 2 cut(s) 12, 64
BspACI CCGC 1 cut(s) 161
BspANI GGCC 1 cut(s) 305
BspCNI CTCAG 1 cut(s) 296
BspLI GGNNCC 3 cut(s) 66, 130, 304
BspPI GGATC 3 cut(s) 20, 59, 72
BspT104I TTCGAA 1 cut(s) 53
BspT107I GGYRCC 1 cut(s) 128
BsrI ACTGG 1 cut(s) 64
BssMI GATC 2 cut(s) 12, 64
Bst2UI CCWGG 1 cut(s) 243
BstBI TTCGAA 1 cut(s) 53
BstDEI CTNAG 2 cut(s) 283, 354
BstF5I GGATG 4 cut(s) 12, 23, 149, 217
BstKTI GATC 2 cut(s) 15, 67
BstMBI GATC 2 cut(s) 12, 64
BstNI CCWGG 1 cut(s) 243
BstSCI CCNGG 1 cut(s) 241
BstX2I RGATCY 1 cut(s) 64
BstXI CCANNNNNNTGG 2 cut(s) 295, 339
BstYI RGATCY 1 cut(s) 64
BsuRI GGCC 1 cut(s) 305
BtsCI GGATG 4 cut(s) 12, 23, 149, 217
Cfr13I GGNCC 2 cut(s) 273, 303
Csp6I GTAC 2 cut(s) 36, 129
CviJI RGCY 5 cut(s) 178, 287, 293, 305, 335
CviKI_1 RGCY 5 cut(s) 178, 287, 293, 305, 335
CviQI GTAC 2 cut(s) 36, 129
DdeI CTNAG 2 cut(s) 283, 354
DpnI GATC 2 cut(s) 14, 66
DpnII GATC 2 cut(s) 12, 64
Eco47I GGWCC 1 cut(s) 273
EcoRI GAATTC 1 cut(s) 49
EcoRII CCWGG 1 cut(s) 241
FaiI YATR 8 cut(s) 136, 183, 188, 257, 264, 290, 308, 314
FalI AAGNNNNNCTT 2 cut(s) 309, 341
FauI CCCGC 1 cut(s) 168
FokI GGATG 4 cut(s) 10, 19, 136, 204
HaeIII GGCC 1 cut(s) 305
HinfI GANTC 3 cut(s) 229, 246, 321
HphI GGTGA 1 cut(s) 238
Hpy188I TCNGA 1 cut(s) 48
Hpy188III TCNNGA 1 cut(s) 221
HpyAV CCTTC 2 cut(s) 80, 335
HpyF3I CTNAG 2 cut(s) 283, 354
KpnI GGTACC 1 cut(s) 132
Kzo9I GATC 2 cut(s) 12, 64
LmnI GCTCC 1 cut(s) 352
LpnPI CCDG 7 cut(s) 45, 149, 204, 228, 234, 255, 345
LweI GCATC 1 cut(s) 203
MaeIII GTNAC 1 cut(s) 77
MalI GATC 2 cut(s) 14, 66
MboI GATC 2 cut(s) 12, 64
MflI RGATCY 1 cut(s) 64
MluCI AATT 2 cut(s) 49, 95
MnlI CCTC 2 cut(s) 217, 292
MspA1I CMGCKG 1 cut(s) 163
MspR9I CCNGG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 243
NdeII GATC 2 cut(s) 12, 64
NlaIV GGNNCC 3 cut(s) 66, 130, 304
NspV TTCGAA 1 cut(s) 53
PfeI GAWTC 3 cut(s) 229, 246, 321
Psp6I CCWGG 1 cut(s) 241
PspGI CCWGG 1 cut(s) 241
PspN4I GGNNCC 3 cut(s) 66, 130, 304
PspPI GGNCC 2 cut(s) 273, 303
PsuI RGATCY 1 cut(s) 64
RsaI GTAC 2 cut(s) 37, 130
RsaNI GTAC 2 cut(s) 36, 129
Sau3AI GATC 2 cut(s) 12, 64
Sau96I GGNCC 2 cut(s) 273, 303
ScrFI CCNGG 1 cut(s) 243
SetI ASST 3 cut(s) 228, 295, 337
SfaNI GCATC 1 cut(s) 203
SfuI TTCGAA 1 cut(s) 53
SinI GGWCC 1 cut(s) 273
Sse9I AATT 2 cut(s) 49, 95
SsiI CCGC 1 cut(s) 161
StyD4I CCNGG 1 cut(s) 241
TaqI TCGA 2 cut(s) 53, 114
TasI AATT 2 cut(s) 49, 95
TfiI GAWTC 3 cut(s) 229, 246, 321
VpaK11BI GGWCC 1 cut(s) 273
XapI RAATTY 2 cut(s) 49, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.