Rroxscaffold_2G00118940

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
50798511 .. 50799249
739 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00118940.1

Sequence Viewer

Length: 303 bp
ATGCCGCCAGCGTTCATCCTGAGCCAGGATCGAACTCTCCATGAGATTCATAACAAAGCGGATTCGGAATTGTCTTTCATTCCAAGGCATAACTTGTATCCATGCGCTTCATATTCGCCTGGAGTTCGCTCCCAGAAATATAGCCATCCCTACCCCCTCACGTCAATCCCACGAGCCTCTTATCCATTCTCATTCGATCACGGCGGGGAAGCAAATAAAAATGGAAAAACTCACATTGGGTTTAGGGATAATCAGGCTCGAACTGATGACTTCCACCACGTCAAGGTGACACTCTACCGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.48

Weight (kDa)

9.17

Isoelectric Point (pI)

51.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 5, 59, 204, 298
AclWI GGATC 1 cut(s) 36
AfiI CCNNNNNNNGG 2 cut(s) 25, 283
AjiI CACGTC 2 cut(s) 162, 280
AjnI CCWGG 2 cut(s) 24, 118
AlwI GGATC 1 cut(s) 36
AspLEI GCGC 1 cut(s) 107
AsuHPI GGTGA 1 cut(s) 298
BauI CACGAG 1 cut(s) 171
BccI CCATC 1 cut(s) 153
BceAI ACGGC 1 cut(s) 217
BciT130I CCWGG 2 cut(s) 26, 120
BciVI GTATCC 1 cut(s) 108
BfuI GTATCC 1 cut(s) 108
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
Bme1390I CCNGG 2 cut(s) 26, 120
BmgBI CACGTC 2 cut(s) 162, 280
BmrFI CCNGG 2 cut(s) 26, 120
BpmI CTGGAG 1 cut(s) 141
Bpu10I CCTNAGC 1 cut(s) 20
BsaJI CCNNGG 1 cut(s) 83
Bsc4I CCNNNNNNNGG 2 cut(s) 25, 283
BseBI CCWGG 2 cut(s) 26, 120
BseDI CCNNGG 1 cut(s) 83
BseGI GGATG 2 cut(s) 15, 145
BseLI CCNNNNNNNGG 2 cut(s) 25, 283
BseMII CTCAG 1 cut(s) 11
BslI CCNNNNNNNGG 2 cut(s) 25, 283
Bsp143I GATC 2 cut(s) 28, 196
BspACI CCGC 4 cut(s) 5, 59, 204, 298
BspCNI CTCAG 1 cut(s) 12
BspPI GGATC 1 cut(s) 36
BssECI CCNNGG 1 cut(s) 83
BssMI GATC 2 cut(s) 28, 196
BssSI CACGAG 1 cut(s) 171
BssT1I CCWWGG 1 cut(s) 83
Bst2BI CACGAG 1 cut(s) 171
Bst2UI CCWGG 2 cut(s) 26, 120
BstC8I GCNNGC 1 cut(s) 9
BstDEI CTNAG 1 cut(s) 20
BstENI CCTNNNNNAGG 1 cut(s) 23
BstF5I GGATG 2 cut(s) 15, 145
BstHHI GCGC 1 cut(s) 107
BstKTI GATC 2 cut(s) 31, 199
BstMBI GATC 2 cut(s) 28, 196
BstNI CCWGG 2 cut(s) 26, 120
BstSCI CCNGG 2 cut(s) 24, 118
BsuI GTATCC 1 cut(s) 108
BtrI CACGTC 2 cut(s) 162, 280
BtsCI GGATG 2 cut(s) 15, 145
Cac8I GCNNGC 1 cut(s) 9
CfoI GCGC 1 cut(s) 107
CviAII CATG 2 cut(s) 41, 102
CviJI RGCY 4 cut(s) 24, 144, 176, 257
CviKI_1 RGCY 4 cut(s) 24, 144, 176, 257
DdeI CTNAG 1 cut(s) 20
DpnI GATC 2 cut(s) 30, 198
DpnII GATC 2 cut(s) 28, 196
Eco130I CCWWGG 1 cut(s) 83
EcoNI CCTNNNNNAGG 1 cut(s) 23
EcoRII CCWGG 2 cut(s) 24, 118
EcoT14I CCWWGG 1 cut(s) 83
ErhI CCWWGG 1 cut(s) 83
FaeI CATG 2 cut(s) 44, 105
FaiI YATR 6 cut(s) 42, 51, 90, 103, 112, 141
FatI CATG 2 cut(s) 40, 101
FauI CCCGC 1 cut(s) 197
Fnu4HI GCNGC 1 cut(s) 5
FokI GGATG 2 cut(s) 2, 132
Fsp4HI GCNGC 1 cut(s) 5
GlaI GCGC 1 cut(s) 106
GluI GCNGC 1 cut(s) 5
GsuI CTGGAG 1 cut(s) 141
HhaI GCGC 1 cut(s) 107
Hin1II CATG 2 cut(s) 44, 105
Hin6I GCGC 1 cut(s) 105
HinP1I GCGC 1 cut(s) 105
HinfI GANTC 2 cut(s) 46, 62
HphI GGTGA 1 cut(s) 298
Hpy188I TCNGA 1 cut(s) 67
Hpy188III TCNNGA 1 cut(s) 19
HpyCH4IV ACGT 2 cut(s) 161, 279
HpyF3I CTNAG 1 cut(s) 20
HpySE526I ACGT 2 cut(s) 161, 279
Hsp92II CATG 2 cut(s) 44, 105
HspAI GCGC 1 cut(s) 105
Kzo9I GATC 2 cut(s) 28, 196
LmnI GCTCC 1 cut(s) 134
LpnPI CCDG 8 cut(s) 11, 21, 32, 38, 105, 132, 146, 239
MaeII ACGT 2 cut(s) 161, 279
MaeIII GTNAC 1 cut(s) 286
MalI GATC 2 cut(s) 30, 198
MboI GATC 2 cut(s) 28, 196
MluCI AATT 1 cut(s) 68
MnlI CCTC 2 cut(s) 167, 187
MspA1I CMGCKG 1 cut(s) 300
MspR9I CCNGG 2 cut(s) 26, 120
MvaI CCWGG 2 cut(s) 26, 120
NdeII GATC 2 cut(s) 28, 196
NlaIII CATG 2 cut(s) 44, 105
NmuCI GTSAC 1 cut(s) 286
PfeI GAWTC 2 cut(s) 46, 62
PkrI GCNGC 1 cut(s) 6
Psp6I CCWGG 2 cut(s) 24, 118
PspGI CCWGG 2 cut(s) 24, 118
SatI GCNGC 1 cut(s) 5
Sau3AI GATC 2 cut(s) 28, 196
ScrFI CCNGG 2 cut(s) 26, 120
SetI ASST 3 cut(s) 164, 282, 288
Sse9I AATT 1 cut(s) 68
SsiI CCGC 4 cut(s) 5, 59, 204, 298
StyD4I CCNGG 2 cut(s) 24, 118
StyI CCWWGG 1 cut(s) 83
TaiI ACGT 2 cut(s) 164, 282
TaqI TCGA 3 cut(s) 31, 195, 259
TasI AATT 1 cut(s) 68
TauI GCSGC 1 cut(s) 7
TfiI GAWTC 2 cut(s) 46, 62
TseFI GTSAC 1 cut(s) 286
Tsp45I GTSAC 1 cut(s) 286
TspDTI ATGAA 4 cut(s) 4, 38, 67, 99
XagI CCTNNNNNAGG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.