Rh1BG209300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
32788524 .. 32788817
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG209300.1

Sequence Viewer

Length: 294 bp
ATGAGATTCATAGTTGCATTACTTATAGTTTCCTTGTTCGTAGACACAGCGGATTCGGAATTGTCTTTCATTCCAAGGCATAACTTGTATCCATGCGCTTCATATTCGCCTGGAGTTCGCTCCCAGAAATATAGCCATCCCTACCCCCTCACGTCAATCCCACGAGCCTCTTATCCATTCTCATTCCATCACGGCGGGGAAGCAAATAAAAATGGAAAAACTCACATTGGGTTTAGGGATAATCAGGCTCGAACTGATGACTTCCACCACGTCAAGGTGACACTCTACCGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.09

Weight (kDa)

9.46

Isoelectric Point (pI)

24.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 42
AciI CCGC 3 cut(s) 50, 195, 289
AfiI CCNNNNNNNGG 1 cut(s) 274
AjiI CACGTC 2 cut(s) 153, 271
AjnI CCWGG 1 cut(s) 109
AspLEI GCGC 1 cut(s) 98
AsuHPI GGTGA 1 cut(s) 289
BauI CACGAG 1 cut(s) 162
BccI CCATC 2 cut(s) 144, 195
BceAI ACGGC 1 cut(s) 208
BciT130I CCWGG 1 cut(s) 111
BciVI GTATCC 1 cut(s) 99
BfuI GTATCC 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 111
BmgBI CACGTC 2 cut(s) 153, 271
BmrFI CCNGG 1 cut(s) 111
BpmI CTGGAG 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 74
Bsc4I CCNNNNNNNGG 1 cut(s) 274
BseBI CCWGG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 74
BseGI GGATG 1 cut(s) 136
BseLI CCNNNNNNNGG 1 cut(s) 274
BslI CCNNNNNNNGG 1 cut(s) 274
BspACI CCGC 3 cut(s) 50, 195, 289
BssECI CCNNGG 1 cut(s) 74
BssSI CACGAG 1 cut(s) 162
BssT1I CCWWGG 1 cut(s) 74
Bst2BI CACGAG 1 cut(s) 162
Bst2UI CCWGG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 136
BstHHI GCGC 1 cut(s) 98
BstNI CCWGG 1 cut(s) 111
BstSCI CCNGG 1 cut(s) 109
BsuI GTATCC 1 cut(s) 99
BtrI CACGTC 2 cut(s) 153, 271
BtsCI GGATG 1 cut(s) 136
CfoI GCGC 1 cut(s) 98
CviAII CATG 1 cut(s) 93
CviJI RGCY 3 cut(s) 135, 167, 248
CviKI_1 RGCY 3 cut(s) 135, 167, 248
Eco130I CCWWGG 1 cut(s) 74
EcoRII CCWGG 1 cut(s) 109
EcoT14I CCWWGG 1 cut(s) 74
ErhI CCWWGG 1 cut(s) 74
FaeI CATG 1 cut(s) 96
FaiI YATR 6 cut(s) 11, 26, 81, 94, 103, 132
FatI CATG 1 cut(s) 92
FauI CCCGC 1 cut(s) 188
FblI GTMKAC 1 cut(s) 42
FokI GGATG 1 cut(s) 123
GlaI GCGC 1 cut(s) 97
GsuI CTGGAG 1 cut(s) 132
HhaI GCGC 1 cut(s) 98
Hin1II CATG 1 cut(s) 96
Hin6I GCGC 1 cut(s) 96
HinP1I GCGC 1 cut(s) 96
HinfI GANTC 2 cut(s) 6, 53
HphI GGTGA 1 cut(s) 289
Hpy166II GTNNAC 1 cut(s) 43
Hpy188I TCNGA 1 cut(s) 58
Hpy8I GTNNAC 1 cut(s) 43
HpyCH4IV ACGT 2 cut(s) 152, 270
HpyCH4V TGCA 1 cut(s) 17
HpySE526I ACGT 2 cut(s) 152, 270
Hsp92II CATG 1 cut(s) 96
HspAI GCGC 1 cut(s) 96
LmnI GCTCC 1 cut(s) 125
LpnPI CCDG 4 cut(s) 96, 123, 137, 230
MaeII ACGT 2 cut(s) 152, 270
MaeIII GTNAC 1 cut(s) 277
MluCI AATT 1 cut(s) 59
MnlI CCTC 2 cut(s) 158, 178
MspA1I CMGCKG 2 cut(s) 50, 291
MspR9I CCNGG 1 cut(s) 111
MvaI CCWGG 1 cut(s) 111
NlaIII CATG 1 cut(s) 96
NmuCI GTSAC 1 cut(s) 277
PfeI GAWTC 2 cut(s) 6, 53
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
ScrFI CCNGG 1 cut(s) 111
SetI ASST 3 cut(s) 155, 273, 279
Sse9I AATT 1 cut(s) 59
SsiI CCGC 3 cut(s) 50, 195, 289
StyD4I CCNGG 1 cut(s) 109
StyI CCWWGG 1 cut(s) 74
TaiI ACGT 2 cut(s) 155, 273
TaqI TCGA 1 cut(s) 250
TasI AATT 1 cut(s) 59
TfiI GAWTC 2 cut(s) 6, 53
TseFI GTSAC 1 cut(s) 277
Tsp45I GTSAC 1 cut(s) 277
TspDTI ATGAA 2 cut(s) 58, 90
XmiI GTMKAC 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.