Rw4G000200

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Forward (+)
421690 .. 422565
876 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G000200.1

Sequence Viewer

Length: 240 bp
ATGCAGATCTGGGATGAACACACATCAACATGTTTTGGCCTTTTTGCAATATACAGATTTGATTTGGGTTTGGGTTTAATTAAGGAGTTGGCCGTCTTAAGTTCCTCCTCAGTGCAACTCCTGGTTGTGTCTTCCCCGGAGGAAACTCGAATGTCATCGTTGTCGGATAATAGACTTGCAAAAAGTTTAGAAAACCGTCAGAGTGCTAGAAGTGTAACAGAGCCATGTCATCCCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.81

Weight (kDa)

6.05

Isoelectric Point (pI)

55.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 90
AflII CTTAAG 1 cut(s) 97
AflIII ACRYGT 1 cut(s) 29
AjnI CCWGG 1 cut(s) 120
AoxI GGCC 2 cut(s) 37, 90
AsuC2I CCSGG 1 cut(s) 137
BbsI GAAGAC 1 cut(s) 123
BceAI ACGGC 1 cut(s) 77
BciT130I CCWGG 1 cut(s) 122
BcnI CCSGG 1 cut(s) 137
BfaI CTAG 1 cut(s) 207
BfrI CTTAAG 1 cut(s) 97
BglII AGATCT 1 cut(s) 6
Bme1390I CCNGG 2 cut(s) 122, 137
BmrFI CCNGG 2 cut(s) 122, 137
BpiI GAAGAC 1 cut(s) 123
BpuMI CCSGG 1 cut(s) 137
BsaJI CCNNGG 1 cut(s) 135
BseBI CCWGG 1 cut(s) 122
BseDI CCNNGG 1 cut(s) 135
BseGI GGATG 2 cut(s) 19, 229
BseMII CTCAG 1 cut(s) 123
BseRI GAGGAG 1 cut(s) 97
BshFI GGCC 2 cut(s) 39, 92
BsiSI CCGG 1 cut(s) 137
BsnI GGCC 2 cut(s) 39, 92
Bsp143I GATC 1 cut(s) 6
BspANI GGCC 2 cut(s) 39, 92
BspCNI CTCAG 1 cut(s) 122
BspTI CTTAAG 1 cut(s) 97
BssECI CCNNGG 1 cut(s) 135
BssMI GATC 1 cut(s) 6
Bst2UI CCWGG 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 197
BstAFI CTTAAG 1 cut(s) 97
BstDEI CTNAG 1 cut(s) 109
BstF5I GGATG 2 cut(s) 19, 229
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstNI CCWGG 1 cut(s) 122
BstNSI RCATGY 1 cut(s) 33
BstSCI CCNGG 2 cut(s) 120, 135
BstV2I GAAGAC 1 cut(s) 123
BstX2I RGATCY 1 cut(s) 6
BstYI RGATCY 1 cut(s) 6
BsuRI GGCC 2 cut(s) 39, 92
BtsCI GGATG 2 cut(s) 19, 229
BtsIMutI CAGTG 1 cut(s) 117
CviAII CATG 2 cut(s) 30, 225
CviJI RGCY 3 cut(s) 39, 92, 223
CviKI_1 RGCY 3 cut(s) 39, 92, 223
DdeI CTNAG 1 cut(s) 109
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
EaeI YGGCCR 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 120
FaeI CATG 2 cut(s) 33, 228
FaiI YATR 3 cut(s) 31, 52, 226
FatI CATG 2 cut(s) 29, 224
FokI GGATG 2 cut(s) 26, 216
FspBI CTAG 1 cut(s) 207
HaeIII GGCC 2 cut(s) 39, 92
HapII CCGG 1 cut(s) 137
Hin1II CATG 2 cut(s) 33, 228
HpaII CCGG 1 cut(s) 137
Hpy188I TCNGA 2 cut(s) 166, 201
HpyCH4III ACNGT 1 cut(s) 197
HpyCH4V TGCA 4 cut(s) 4, 47, 115, 179
HpyF3I CTNAG 1 cut(s) 109
Hsp92II CATG 2 cut(s) 33, 228
Kzo9I GATC 1 cut(s) 6
LpnPI CCDG 3 cut(s) 107, 134, 150
MaeI CTAG 1 cut(s) 207
MaeIII GTNAC 1 cut(s) 214
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 1 cut(s) 123
MflI RGATCY 1 cut(s) 6
MluCI AATT 1 cut(s) 78
MmeI TCCRAC 1 cut(s) 144
MnlI CCTC 3 cut(s) 115, 118, 133
MseI TTAA 3 cut(s) 77, 81, 98
MslI CAYNNNNRTG 1 cut(s) 28
MspCI CTTAAG 1 cut(s) 97
MspI CCGG 1 cut(s) 137
MspR9I CCNGG 2 cut(s) 122, 137
MvaI CCWGG 1 cut(s) 122
NciI CCSGG 1 cut(s) 137
NdeII GATC 1 cut(s) 6
NlaIII CATG 2 cut(s) 33, 228
NspI RCATGY 1 cut(s) 33
PacI TTAATTAA 1 cut(s) 81
PciI ACATGT 1 cut(s) 29
PscI ACATGT 1 cut(s) 29
Psp6I CCWGG 1 cut(s) 120
PspGI CCWGG 1 cut(s) 120
PsuI RGATCY 1 cut(s) 6
RseI CAYNNNNRTG 1 cut(s) 28
SaqAI TTAA 3 cut(s) 77, 81, 98
Sau3AI GATC 1 cut(s) 6
ScrFI CCNGG 2 cut(s) 122, 137
SgeI CNNG 9 cut(s) 22, 42, 133, 134, 148, 149, 159, 188, 219
SmiMI CAYNNNNRTG 1 cut(s) 28
SmlI CTYRAG 1 cut(s) 97
SmoI CTYRAG 1 cut(s) 97
Sse9I AATT 1 cut(s) 78
SspMI CTAG 1 cut(s) 207
StyD4I CCNGG 2 cut(s) 120, 135
TaaI ACNGT 1 cut(s) 197
TaqI TCGA 1 cut(s) 148
TasI AATT 1 cut(s) 78
Tru1I TTAA 3 cut(s) 77, 81, 98
Tru9I TTAA 3 cut(s) 77, 81, 98
TscAI CASTG 1 cut(s) 117
TspDTI ATGAA 1 cut(s) 30
TspRI CASTG 1 cut(s) 117
Vha464I CTTAAG 1 cut(s) 97
XceI RCATGY 1 cut(s) 33
XspI CTAG 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.