Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010103.1

Orthogroup ID

OG0010587

Physical Location & Seq

Genomic Coordinates Reverse (-)

10130 .. 10779

Gene Structure 650 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010103.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 426 bp

atgaaattcaagggtttcattttgctagggcttctgtttgcagtagttctcatctcttccattgacgcagcggctgagacatccaaacatgagaataaagaggacctggcactggctgtccacatggaggcagcactacaggtgttggcgctattccaggtgttggaggcggcattccgggttttggaggcggcattccgggtgttggaggcggcattccgggggttggaggaggcattccgggggttggaggcggcattccgggcgttggaggaggcattcccggcgttggaggaggcagcattccgggtgttggaggaggcgttccaggtgttggaggcattccgggggttggcggtggcgttccagggaatggcggcattccacgcgttggacgcggtgttccaggggttggtggaggaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

141

Amino Acids

15.42

Weight (kDa)

4.68

Isoelectric Point (pI)

28.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010587)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g41601 FvH4_6g41604
prunus_persica	Prupe.3G205600_v2.0.a1 Prupe.3G205700_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0157361
rosa_laevigata	RLG00000020978 RLG00000020980 RLG00000020981
rosa_multiflora	Rmu_sc0010103.1_g000006
rosa_roxburghii	Rroxscaffold_1G00029540 Rroxscaffold_2G00092280 Rroxscaffold_2G00092300
rosa_rugosa	Rorug02G0459700 Rorug02G0459900
rosa_samantha	Rh2AG524600 Rh2BG539000 Rh2CG509400 Rh2CG509600 Rh2DG547900
rosa_wichuraiana	Rw2G043430 Rw2G043440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	5 cut(s)	163, 334, 373, 391, 412
AccII	CGCG	2 cut(s)	389, 398
AciI	CCGC	8 cut(s)	71, 170, 191, 212, 254, 356, 377, 398
AcsI	RAATTY	1 cut(s)	5
AflIII	ACRYGT	1 cut(s)	387
AgsI	TTSAA	1 cut(s)	10
AjnI	CCWGG	5 cut(s)	105, 156, 327, 366, 405
AloI	GAACNNNNNNTCC	4 cut(s)	308, 340, 386, 418
Alw26I	GTCTC	1 cut(s)	71
AlwNI	CAGNNNCTG	1 cut(s)	74
ApeKI	GCWGC	3 cut(s)	68, 131, 299
ApoI	RAATTY	1 cut(s)	5
AspLEI	GCGC	1 cut(s)	151
AspS9I	GGNCC	1 cut(s)	103
AsuC2I	CCSGG	8 cut(s)	179, 200, 221, 242, 263, 284, 308, 347
AvaII	GGWCC	1 cut(s)	103
BbvI	GCAGC	3 cut(s)	80, 143, 311
BciT130I	CCWGG	5 cut(s)	107, 158, 329, 368, 407
BcnI	CCSGG	8 cut(s)	179, 200, 221, 242, 263, 284, 308, 347
BcoDI	GTCTC	1 cut(s)	71
BfaI	CTAG	1 cut(s)	26
BfmI	CTRYAG	1 cut(s)	137
BfoI	RGCGCY	1 cut(s)	152
BisI	GCNGC	9 cut(s)	69, 72, 132, 171, 192, 213, 255, 300, 378
BlsI	GCNGC	9 cut(s)	70, 73, 133, 172, 193, 214, 256, 301, 379
Bme18I	GGWCC	1 cut(s)	103
BmgT120I	GGNCC	1 cut(s)	103
BpuMI	CCSGG	8 cut(s)	179, 200, 221, 242, 263, 284, 308, 347
BsaJI	CCNNGG	5 cut(s)	220, 241, 346, 367, 406
BsaXI	ACNNNNNCTCC	2 cut(s)	308, 338
Bse1I	ACTGG	1 cut(s)	117
BseBI	CCWGG	5 cut(s)	107, 158, 329, 368, 407
BseDI	CCNNGG	5 cut(s)	220, 241, 346, 367, 406
BseGI	GGATG	1 cut(s)	80
BseMII	CTCAG	1 cut(s)	66
BseNI	ACTGG	1 cut(s)	117
BseRI	GAGGAG	4 cut(s)	245, 287, 308, 332
BseXI	GCAGC	3 cut(s)	80, 143, 311
Bsh1236I	CGCG	2 cut(s)	389, 398
BsiSI	CCGG	8 cut(s)	178, 199, 220, 241, 262, 284, 307, 346
BsmAI	GTCTC	1 cut(s)	71
BsmI	GAATGC	9 cut(s)	173, 194, 215, 236, 257, 278, 302, 341, 380
BspACI	CCGC	8 cut(s)	71, 170, 191, 212, 254, 356, 377, 398
BspCNI	CTCAG	1 cut(s)	67
BspFNI	CGCG	2 cut(s)	389, 398
BsrI	ACTGG	1 cut(s)	117
BssECI	CCNNGG	5 cut(s)	220, 241, 346, 367, 406
Bst2UI	CCWGG	5 cut(s)	107, 158, 329, 368, 407
Bst6I	CTCTTC	1 cut(s)	61
BstDEI	CTNAG	1 cut(s)	75
BstF5I	GGATG	1 cut(s)	80
BstFNI	CGCG	2 cut(s)	389, 398
BstH2I	RGCGCY	1 cut(s)	152
BstHHI	GCGC	1 cut(s)	151
BstMAI	GTCTC	1 cut(s)	71
BstMWI	GCNNNNNNNGC	4 cut(s)	263, 284, 386, 395
BstNI	CCWGG	5 cut(s)	107, 158, 329, 368, 407
BstSFI	CTRYAG	1 cut(s)	137
BstUI	CGCG	2 cut(s)	389, 398
BstV1I	GCAGC	3 cut(s)	80, 143, 311
BtsCI	GGATG	1 cut(s)	80
BtsIMutI	CAGTG	1 cut(s)	110
CaiI	CAGNNNCTG	1 cut(s)	74
CfoI	GCGC	1 cut(s)	151
Cfr13I	GGNCC	1 cut(s)	103
CseI	GACGC	2 cut(s)	74, 404
CviAII	CATG	2 cut(s)	89, 124
CviJI	RGCY	3 cut(s)	31, 74, 116
CviKI_1	RGCY	3 cut(s)	31, 74, 116
DdeI	CTNAG	1 cut(s)	75
Eam1104I	CTCTTC	1 cut(s)	61
EarI	CTCTTC	1 cut(s)	61
Eco47I	GGWCC	1 cut(s)	103
EcoO109I	RGGNCCY	1 cut(s)	103
EcoRII	CCWGG	5 cut(s)	105, 156, 327, 366, 405
FaeI	CATG	2 cut(s)	92, 127
FaiI	YATR	2 cut(s)	90, 125
FatI	CATG	2 cut(s)	88, 123
Fnu4HI	GCNGC	9 cut(s)	69, 72, 132, 171, 192, 213, 255, 300, 378
FokI	GGATG	1 cut(s)	67
Fsp4HI	GCNGC	9 cut(s)	69, 72, 132, 171, 192, 213, 255, 300, 378
FspBI	CTAG	1 cut(s)	26
GlaI	GCGC	1 cut(s)	150
GluI	GCNGC	9 cut(s)	69, 72, 132, 171, 192, 213, 255, 300, 378
HaeII	RGCGCY	1 cut(s)	152
HapII	CCGG	8 cut(s)	178, 199, 220, 241, 262, 284, 307, 346
HgaI	GACGC	2 cut(s)	74, 404
HhaI	GCGC	1 cut(s)	151
Hin1II	CATG	2 cut(s)	92, 127
Hin6I	GCGC	1 cut(s)	149
HinP1I	GCGC	1 cut(s)	149
HpaII	CCGG	8 cut(s)	178, 199, 220, 241, 262, 284, 307, 346
Hpy166II	GTNNAC	1 cut(s)	121
Hpy8I	GTNNAC	1 cut(s)	121
HpyCH4V	TGCA	1 cut(s)	41
HpyF10VI	GCNNNNNNNGC	4 cut(s)	263, 284, 386, 395
HpyF3I	CTNAG	1 cut(s)	75
Hsp92II	CATG	2 cut(s)	92, 127
HspAI	GCGC	1 cut(s)	149
Lsp1109I	GCAGC	3 cut(s)	80, 143, 311
MaeI	CTAG	1 cut(s)	26
MboII	GAAGA	1 cut(s)	48
MluCI	AATT	1 cut(s)	5
MluI	ACGCGT	1 cut(s)	387
MmeI	TCCRAC	9 cut(s)	144, 186, 207, 228, 249, 270, 294, 315, 372
MspA1I	CMGCKG	1 cut(s)	71
MspI	CCGG	8 cut(s)	178, 199, 220, 241, 262, 284, 307, 346
Mva1269I	GAATGC	9 cut(s)	173, 194, 215, 236, 257, 278, 302, 341, 380
MvaI	CCWGG	5 cut(s)	107, 158, 329, 368, 407
MvnI	CGCG	2 cut(s)	389, 398
MwoI	GCNNNNNNNGC	4 cut(s)	263, 284, 386, 395
NciI	CCSGG	8 cut(s)	179, 200, 221, 242, 263, 284, 308, 347
NlaIII	CATG	2 cut(s)	92, 127
PctI	GAATGC	9 cut(s)	173, 194, 215, 236, 257, 278, 302, 341, 380
PflMI	CCANNNNNTGG	5 cut(s)	163, 334, 373, 391, 412
PkrI	GCNGC	9 cut(s)	70, 73, 133, 172, 193, 214, 256, 301, 379
PpuMI	RGGWCCY	1 cut(s)	103
Psp5II	RGGWCCY	1 cut(s)	103
Psp6I	CCWGG	5 cut(s)	105, 156, 327, 366, 405
PspGI	CCWGG	5 cut(s)	105, 156, 327, 366, 405
PspPI	GGNCC	1 cut(s)	103
PspPPI	RGGWCCY	1 cut(s)	103
PstNI	CAGNNNCTG	1 cut(s)	74
SatI	GCNGC	9 cut(s)	69, 72, 132, 171, 192, 213, 255, 300, 378
Sau96I	GGNCC	1 cut(s)	103
SetI	ASST	4 cut(s)	108, 144, 162, 333
SfcI	CTRYAG	1 cut(s)	137
SinI	GGWCC	1 cut(s)	103
Sse9I	AATT	1 cut(s)	5
SsiI	CCGC	8 cut(s)	71, 170, 191, 212, 254, 356, 377, 398
SspMI	CTAG	1 cut(s)	26
TasI	AATT	1 cut(s)	5
TauI	GCSGC	6 cut(s)	74, 173, 194, 215, 257, 380
TscAI	CASTG	1 cut(s)	117
TseI	GCWGC	3 cut(s)	68, 131, 299
TspDTI	ATGAA	2 cut(s)	7, 17
TspRI	CASTG	1 cut(s)	117
Van91I	CCANNNNNTGG	5 cut(s)	163, 334, 373, 391, 412
VpaK11BI	GGWCC	1 cut(s)	103
XapI	RAATTY	1 cut(s)	5
XspI	CTAG	1 cut(s)	26

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.