Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011205.1

Orthogroup ID

OG0006426

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1222

Gene Structure 1222 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011205.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 262 bp

atgcagactaccataagagacatggcgacagatctgttttgcaagacgggggatttggatttgggtattcgatcagtctgtggtgatatggtgaaggttaaggtgtcgctgaatttgtttgcttttacttctttgattgatgggtattgtaaggctggtagtttagaggttgcaaatggattgcttaagggaataaataaatcattagttttaccagagagagcgaagaaggacgcgatcaagaaggcagcatgtgccgtgg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_1 PPR_2 PPR_3

Protein Analysis

87

Amino Acids

9.29

Weight (kDa)

9.0

Isoelectric Point (pI)

16.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006426)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0408691
rosa_laevigata	RLG00000003120 RLG00000007481 RLG00000023669
rosa_multiflora	Rmu_sc0004465.1_g000035 Rmu_sc0008178.1_g000001 Rmu_sc0011205.1_g000001
rosa_samantha	Rh1BG007500 Rh1CG013300 Rh1DG008900 Rh1DG187600 Rh2AG226300 Rh2AG399500 Rh2CG229400 Rh3AG181200 Rh3BG082400 Rh3CG204700 Rh3CG275900 Rh3DG354200 Rh5BG257500 Rh5BG483900 Rh5CG147800 Rh5CG423000 Rh5CG508500 Rh6BG193200 Rh7BG133800 Rh7DG092600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	236
AcsI	RAATTY	1 cut(s)	112
AflII	CTTAAG	1 cut(s)	185
Alw26I	GTCTC	1 cut(s)	12
ApeKI	GCWGC	1 cut(s)	248
ApoI	RAATTY	1 cut(s)	112
ArsI	GACNNNNNNTTYG	2 cut(s)	37, 69
AsuHPI	GGTGA	2 cut(s)	95, 103
BccI	CCATC	1 cut(s)	134
BceAI	ACGGC	1 cut(s)	242
BcoDI	GTCTC	1 cut(s)	12
BfrI	CTTAAG	1 cut(s)	185
BglII	AGATCT	1 cut(s)	31
BisI	GCNGC	1 cut(s)	249
BlsI	GCNGC	1 cut(s)	250
BsaJI	CCNNGG	1 cut(s)	258
BseDI	CCNNGG	1 cut(s)	258
Bsh1236I	CGCG	1 cut(s)	236
BsmAI	GTCTC	1 cut(s)	12
Bsp143I	GATC	3 cut(s)	31, 71, 237
BspFNI	CGCG	1 cut(s)	236
BspTI	CTTAAG	1 cut(s)	185
BssECI	CCNNGG	1 cut(s)	258
BssMI	GATC	3 cut(s)	31, 71, 237
BstAFI	CTTAAG	1 cut(s)	185
BstAPI	GCANNNNNTGC	1 cut(s)	254
BstDSI	CCRYGG	1 cut(s)	258
BstFNI	CGCG	1 cut(s)	236
BstKTI	GATC	3 cut(s)	34, 74, 240
BstMAI	GTCTC	1 cut(s)	12
BstMBI	GATC	3 cut(s)	31, 71, 237
BstMWI	GCNNNNNNNGC	1 cut(s)	254
BstNSI	RCATGY	1 cut(s)	255
BstUI	CGCG	1 cut(s)	236
BstX2I	RGATCY	1 cut(s)	31
BstYI	RGATCY	1 cut(s)	31
BtgI	CCRYGG	1 cut(s)	258
CseI	GACGC	1 cut(s)	242
CviAII	CATG	2 cut(s)	22, 252
CviJI	RGCY	1 cut(s)	155
CviKI_1	RGCY	1 cut(s)	155
DpnI	GATC	3 cut(s)	33, 73, 239
DpnII	GATC	3 cut(s)	31, 71, 237
FaeI	CATG	2 cut(s)	25, 255
FaiI	YATR	4 cut(s)	14, 23, 89, 253
FatI	CATG	2 cut(s)	21, 251
Fnu4HI	GCNGC	1 cut(s)	249
Fsp4HI	GCNGC	1 cut(s)	249
GluI	GCNGC	1 cut(s)	249
HgaI	GACGC	1 cut(s)	242
Hin1II	CATG	2 cut(s)	25, 255
HphI	GGTGA	2 cut(s)	95, 103
Hpy188III	TCNNGA	1 cut(s)	241
HpyAV	CCTTC	3 cut(s)	88, 223, 238
HpyCH4V	TGCA	3 cut(s)	4, 42, 173
HpyF10VI	GCNNNNNNNGC	1 cut(s)	254
Hsp92II	CATG	2 cut(s)	25, 255
Kzo9I	GATC	3 cut(s)	31, 71, 237
LpnPI	CCDG	2 cut(s)	141, 228
MalI	GATC	3 cut(s)	33, 73, 239
MboI	GATC	3 cut(s)	31, 71, 237
MboII	GAAGA	1 cut(s)	238
MflI	RGATCY	1 cut(s)	31
MluCI	AATT	1 cut(s)	112
MnlI	CCTC	1 cut(s)	160
MseI	TTAA	2 cut(s)	99, 186
MspCI	CTTAAG	1 cut(s)	185
MvnI	CGCG	1 cut(s)	236
MwoI	GCNNNNNNNGC	1 cut(s)	254
NdeII	GATC	3 cut(s)	31, 71, 237
NlaIII	CATG	2 cut(s)	25, 255
NspI	RCATGY	1 cut(s)	255
PkrI	GCNGC	1 cut(s)	250
PsuI	RGATCY	1 cut(s)	31
SaqAI	TTAA	2 cut(s)	99, 186
SatI	GCNGC	1 cut(s)	249
Sau3AI	GATC	3 cut(s)	31, 71, 237
SetI	ASST	3 cut(s)	99, 105, 171
SgeI	CNNG	7 cut(s)	34, 55, 60, 168, 227, 247, 253
SmlI	CTYRAG	1 cut(s)	185
SmoI	CTYRAG	1 cut(s)	185
Sse9I	AATT	1 cut(s)	112
TaqI	TCGA	1 cut(s)	70
TasI	AATT	1 cut(s)	112
Tru1I	TTAA	2 cut(s)	99, 186
Tru9I	TTAA	2 cut(s)	99, 186
TseI	GCWGC	1 cut(s)	248
Vha464I	CTTAAG	1 cut(s)	185
XapI	RAATTY	1 cut(s)	112
XceI	RCATGY	1 cut(s)	255
XcmI	CCANNNNNNNNNTGG	1 cut(s)	19

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.