Rh1BG007500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
894047 .. 894439
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG007500.1

Sequence Viewer

Length: 207 bp
ATGGCACATCCGACTCTTCTCAAGCGCACTGAAGCCACATCGCCGCCGCCTCACCTACACCCAACACTAGCGCGCGTTGATTCTGTCACCTTGTCGAAACAGATTTTGTTGGGCCTGGTGTTTTCGCTGGCAACGATGATGATTAGAGAGGATGAGAGGGTCAAAGGGGATGGGATTGTGAGAATGGTGGAGGGAAGGAAAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.58

Weight (kDa)

9.51

Isoelectric Point (pI)

32.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 73, 75
AciI CCGC 2 cut(s) 44, 47
AcuI CTGAAG 1 cut(s) 51
AjnI CCWGG 1 cut(s) 114
AoxI GGCC 1 cut(s) 112
AspLEI GCGC 3 cut(s) 27, 73, 75
AspS9I GGNCC 1 cut(s) 112
AsuHPI GGTGA 2 cut(s) 44, 79
BccI CCATC 1 cut(s) 164
BciT130I CCWGG 1 cut(s) 116
BfaI CTAG 1 cut(s) 68
BisI GCNGC 2 cut(s) 44, 47
BlsI GCNGC 2 cut(s) 45, 48
Bme1390I CCNGG 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 112
BmrFI CCNGG 1 cut(s) 116
BpuEI CTTGAG 1 cut(s) 5
BseBI CCWGG 1 cut(s) 116
BseGI GGATG 3 cut(s) 7, 157, 175
BsePI GCGCGC 1 cut(s) 71
Bsh1236I CGCG 2 cut(s) 73, 75
BshFI GGCC 1 cut(s) 114
BsnI GGCC 1 cut(s) 114
BspACI CCGC 2 cut(s) 44, 47
BspANI GGCC 1 cut(s) 114
BspFNI CGCG 2 cut(s) 73, 75
BssHII GCGCGC 1 cut(s) 71
Bst2UI CCWGG 1 cut(s) 116
Bst6I CTCTTC 1 cut(s) 21
BstC8I GCNNGC 2 cut(s) 73, 129
BstF5I GGATG 3 cut(s) 7, 157, 175
BstFNI CGCG 2 cut(s) 73, 75
BstHHI GCGC 3 cut(s) 27, 73, 75
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BstUI CGCG 2 cut(s) 73, 75
BsuRI GGCC 1 cut(s) 114
BtgZI GCGATG 1 cut(s) 24
BtsCI GGATG 3 cut(s) 7, 157, 175
BtsIMutI CAGTG 1 cut(s) 27
Cac8I GCNNGC 2 cut(s) 73, 129
CfoI GCGC 3 cut(s) 27, 73, 75
Cfr13I GGNCC 1 cut(s) 112
CviJI RGCY 2 cut(s) 35, 114
CviKI_1 RGCY 2 cut(s) 35, 114
Eam1104I CTCTTC 1 cut(s) 21
EarI CTCTTC 1 cut(s) 21
Eco57I CTGAAG 1 cut(s) 51
EcoRII CCWGG 1 cut(s) 114
Fnu4HI GCNGC 2 cut(s) 44, 47
FokI GGATG 2 cut(s) 164, 182
Fsp4HI GCNGC 2 cut(s) 44, 47
FspBI CTAG 1 cut(s) 68
GlaI GCGC 3 cut(s) 26, 72, 74
GluI GCNGC 2 cut(s) 44, 47
HaeIII GGCC 1 cut(s) 114
HhaI GCGC 3 cut(s) 27, 73, 75
Hin6I GCGC 3 cut(s) 25, 71, 73
HinP1I GCGC 3 cut(s) 25, 71, 73
HinfI GANTC 2 cut(s) 13, 80
HphI GGTGA 2 cut(s) 44, 79
Hpy188I TCNGA 1 cut(s) 12
HpyAV CCTTC 1 cut(s) 189
HspAI GCGC 3 cut(s) 25, 71, 73
LpnPI CCDG 3 cut(s) 101, 113, 128
MaeI CTAG 1 cut(s) 68
MaeIII GTNAC 1 cut(s) 85
MboII GAAGA 1 cut(s) 8
MlyI GAGTC 1 cut(s) 7
MmeI TCCRAC 1 cut(s) 35
MnlI CCTC 4 cut(s) 60, 142, 150, 184
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
MvnI CGCG 2 cut(s) 73, 75
NmuCI GTSAC 1 cut(s) 85
PauI GCGCGC 1 cut(s) 71
PcsI WCGNNNNNNNCGW 1 cut(s) 131
PfeI GAWTC 1 cut(s) 80
PkrI GCNGC 2 cut(s) 45, 48
PleI GAGTC 1 cut(s) 7
PpsI GAGTC 1 cut(s) 7
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PspPI GGNCC 1 cut(s) 112
PteI GCGCGC 1 cut(s) 71
SatI GCNGC 2 cut(s) 44, 47
Sau96I GGNCC 1 cut(s) 112
SchI GAGTC 1 cut(s) 7
ScrFI CCNGG 1 cut(s) 116
SetI ASST 2 cut(s) 57, 92
SgeI CNNG 8 cut(s) 34, 80, 84, 86, 103, 127, 128, 140
SmlI CTYRAG 1 cut(s) 20
SmoI CTYRAG 1 cut(s) 20
SsiI CCGC 2 cut(s) 44, 47
SspMI CTAG 1 cut(s) 68
StyD4I CCNGG 1 cut(s) 114
TaqI TCGA 1 cut(s) 95
TauI GCSGC 2 cut(s) 46, 49
TfiI GAWTC 1 cut(s) 80
TscAI CASTG 1 cut(s) 34
TseFI GTSAC 1 cut(s) 85
Tsp45I GTSAC 1 cut(s) 85
TspRI CASTG 1 cut(s) 34
XspI CTAG 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.