Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012092.1

Orthogroup ID

OG0005861

Physical Location & Seq

Genomic Coordinates Forward (+)

15 .. 1102

Gene Structure 1088 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012092.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 690 bp

atgcagttccttcatttcaaagctactgcaggctcaaaagacttgatagatgatgaaggttttcggaaagcactttacatgatcgatatcggacaaaatgaccttgctcagttgttttccaaaaatctctcgttcacgcaaataacagagaaaatcccaccaattactacagaaatcaagaaagccgttaagactatatatgaccaaggcgggcggaatttttggatacacaacactgggccattgggttgtctccctcaaaaactttcatcagtccagcagagggacatggatacatatggatgcctctcgacctacaatgcggctgcaaaattgttcaatgtaggattgcgtcatacatgcgatgagatgagatttgaattgaaggatgttaaagtagtatatgtagatgtatatgccatcaaatatgacctcattgctaactacaccaaatacggtttcactagtcctctaatggcatgctgtggaaacggaggtcctccatacaactacaacatgaggctgacatgcggctatcccggttctcaggtttgcgaggatggatcccaacttatgagttgggatgggattcactacactgaagcagcaaataccattgtagcttcaaaaatactttccacggattattctataccgccaattccatttgatttctttgttcgtagttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Lipase_GDSL

Protein Analysis

229

Amino Acids

25.74

Weight (kDa)

6.41

Isoelectric Point (pI)

32.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005861)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G09390 AT1G56670 AT1G56670
fragaria_vesca	FvH4_6g08070 FvH4_6g08070
malus_domestica	MD12G1202600.v1.1
prunus_persica	Prupe.6G307900_v2.0.a1 Prupe.6G308000_v2.0.a1 Prupe.6G308000_v2.0.a1 Prupe.6G308100_v2.0.a1 Prupe.6G308400_v2.0.a1 Prupe.6G308400_v2.0.a1
pyrus_communis	pycom12g18910
rosa_chinensis	RchiOBHm_Chr3g0457751
rosa_laevigata	RLG00000025189
rosa_multiflora	Rmu_sc0012092.1_g000001 Rmu_ssc0000446.1_g000033
rosa_roxburghii	Rroxscaffold_6G00421520
rosa_rugosa	Rorug03G0023200 Rorug03G0023300 Rorug03G0023400 Rorug03G0023400
rosa_samantha	Rh3AG083800 Rh3BG086300 Rh3CG086600 Rh3DG087200
rosa_wichuraiana	Rw0G012220 Rw3G007180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	5 cut(s)	210, 214, 323, 531, 656
AclWI	GGATC	2 cut(s)	558, 571
AcsI	RAATTY	1 cut(s)	217
AcuI	CTGAAG	1 cut(s)	621
AfiI	CCNNNNNNNGG	1 cut(s)	283
AgsI	TTSAA	5 cut(s)	19, 340, 380, 385, 627
AhlI	ACTAGT	1 cut(s)	464
AjuI	GAANNNNNNNTTGG	2 cut(s)	443, 475
AluBI	AGCT	2 cut(s)	23, 623
AluI	AGCT	2 cut(s)	23, 623
Alw26I	GTCTC	1 cut(s)	257
AlwI	GGATC	2 cut(s)	558, 571
AoxI	GGCC	1 cut(s)	239
ApeKI	GCWGC	2 cut(s)	326, 605
ApoI	RAATTY	1 cut(s)	217
Asp700I	GAANNNNTTC	1 cut(s)	60
AspS9I	GGNCC	2 cut(s)	239, 497
AsuC2I	CCSGG	1 cut(s)	540
AvaII	GGWCC	1 cut(s)	497
BamHI	GGATCC	1 cut(s)	563
BbvI	GCAGC	2 cut(s)	313, 617
BccI	CCATC	3 cut(s)	428, 554, 578
BceAI	ACGGC	1 cut(s)	170
BciVI	GTATCC	2 cut(s)	219, 286
BcnI	CCSGG	1 cut(s)	540
BcoDI	GTCTC	1 cut(s)	257
BcuI	ACTAGT	1 cut(s)	464
BfaI	CTAG	1 cut(s)	465
BfmI	CTRYAG	2 cut(s)	27, 168
BfuI	GTATCC	2 cut(s)	219, 286
BisI	GCNGC	4 cut(s)	324, 327, 532, 606
BlsI	GCNGC	4 cut(s)	325, 328, 533, 607
Bme1390I	CCNGG	1 cut(s)	540
Bme18I	GGWCC	1 cut(s)	497
BmgT120I	GGNCC	2 cut(s)	239, 497
BmiI	GGNNCC	1 cut(s)	565
BmrFI	CCNGG	1 cut(s)	540
BmrI	ACTGGG	1 cut(s)	246
BmsI	GCATC	1 cut(s)	293
BmuI	ACTGGG	1 cut(s)	246
BpuMI	CCSGG	1 cut(s)	540
Bsa29I	ATCGAT	1 cut(s)	84
BsaBI	GATNNNNATC	1 cut(s)	86
BsaJI	CCNNGG	2 cut(s)	205, 639
Bsc4I	CCNNNNNNNGG	1 cut(s)	283
Bse1I	ACTGG	1 cut(s)	241
Bse3DI	GCAATG	1 cut(s)	435
Bse8I	GATNNNNATC	1 cut(s)	86
BseCI	ATCGAT	1 cut(s)	84
BseDI	CCNNGG	2 cut(s)	205, 639
BseGI	GGATG	4 cut(s)	308, 394, 565, 589
BseJI	GATNNNNATC	1 cut(s)	86
BseLI	CCNNNNNNNGG	1 cut(s)	283
BseMI	GCAATG	1 cut(s)	435
BseMII	CTCAG	2 cut(s)	122, 560
BseNI	ACTGG	1 cut(s)	241
BseXI	GCAGC	2 cut(s)	313, 617
BshFI	GGCC	1 cut(s)	241
BshVI	ATCGAT	1 cut(s)	84
BsiSI	CCGG	1 cut(s)	540
BslFI	GGGAC	1 cut(s)	299
BslI	CCNNNNNNNGG	1 cut(s)	283
BsmAI	GTCTC	1 cut(s)	257
BsmFI	GGGAC	1 cut(s)	299
BsnI	GGCC	1 cut(s)	241
Bsp143I	GATC	2 cut(s)	81, 563
BspACI	CCGC	5 cut(s)	210, 214, 323, 531, 656
BspANI	GGCC	1 cut(s)	241
BspCNI	CTCAG	2 cut(s)	121, 559
BspDI	ATCGAT	1 cut(s)	84
BspLI	GGNNCC	1 cut(s)	565
BspMAI	CTGCAG	1 cut(s)	31
BspPI	GGATC	2 cut(s)	558, 571
BsrDI	GCAATG	1 cut(s)	435
BsrI	ACTGG	1 cut(s)	241
BssECI	CCNNGG	2 cut(s)	205, 639
BssMI	GATC	2 cut(s)	81, 563
BssT1I	CCWWGG	1 cut(s)	205
Bst4CI	ACNGT	1 cut(s)	458
BstC8I	GCNNGC	3 cut(s)	31, 212, 481
BstDEI	CTNAG	2 cut(s)	108, 546
BstDSI	CCRYGG	1 cut(s)	639
BstF5I	GGATG	4 cut(s)	308, 394, 565, 589
BstKTI	GATC	2 cut(s)	84, 566
BstMAI	GTCTC	1 cut(s)	257
BstMBI	GATC	2 cut(s)	81, 563
BstNSI	RCATGY	3 cut(s)	363, 483, 531
BstSCI	CCNGG	1 cut(s)	538
BstSFI	CTRYAG	2 cut(s)	27, 168
BstV1I	GCAGC	2 cut(s)	313, 617
BstX2I	RGATCY	1 cut(s)	563
BstYI	RGATCY	1 cut(s)	563
Bsu15I	ATCGAT	1 cut(s)	84
BsuI	GTATCC	2 cut(s)	219, 286
BsuRI	GGCC	1 cut(s)	241
BsuTUI	ATCGAT	1 cut(s)	84
BtgI	CCRYGG	1 cut(s)	639
BtgZI	GCGATG	1 cut(s)	378
BtsCI	GGATG	4 cut(s)	308, 394, 565, 589
BtsIMutI	CAGTG	2 cut(s)	234, 597
Cac8I	GCNNGC	3 cut(s)	31, 212, 481
Cfr13I	GGNCC	2 cut(s)	239, 497
ClaI	ATCGAT	1 cut(s)	84
CseI	GACGC	1 cut(s)	341
CviAII	CATG	6 cut(s)	79, 289, 360, 480, 517, 528
CviJI	RGCY	8 cut(s)	23, 33, 185, 241, 326, 523, 534, 623
CviKI_1	RGCY	8 cut(s)	23, 33, 185, 241, 326, 523, 534, 623
DdeI	CTNAG	2 cut(s)	108, 546
DpnI	GATC	2 cut(s)	83, 565
DpnII	GATC	2 cut(s)	81, 563
EciI	GGCGGA	1 cut(s)	229
Eco130I	CCWWGG	1 cut(s)	205
Eco32I	GATATC	1 cut(s)	88
Eco47I	GGWCC	1 cut(s)	497
Eco57I	CTGAAG	1 cut(s)	621
EcoO109I	RGGNCCY	1 cut(s)	497
EcoRV	GATATC	1 cut(s)	88
EcoT14I	CCWWGG	1 cut(s)	205
ErhI	CCWWGG	1 cut(s)	205
FaeI	CATG	6 cut(s)	82, 292, 363, 483, 520, 531
FaqI	GGGAC	1 cut(s)	299
FatI	CATG	6 cut(s)	78, 288, 359, 479, 516, 527
FauI	CCCGC	1 cut(s)	203
FauNDI	CATATG	1 cut(s)	298
Fnu4HI	GCNGC	4 cut(s)	324, 327, 532, 606
FokI	GGATG	4 cut(s)	315, 401, 572, 596
Fsp4HI	GCNGC	4 cut(s)	324, 327, 532, 606
FspBI	CTAG	1 cut(s)	465
GluI	GCNGC	4 cut(s)	324, 327, 532, 606
HaeIII	GGCC	1 cut(s)	241
HapII	CCGG	1 cut(s)	540
HgaI	GACGC	1 cut(s)	341
Hin1II	CATG	6 cut(s)	82, 292, 363, 483, 520, 531
HinfI	GANTC	1 cut(s)	589
HpaII	CCGG	1 cut(s)	540
Hpy166II	GTNNAC	1 cut(s)	135
Hpy188I	TCNGA	2 cut(s)	66, 92
Hpy188III	TCNNGA	2 cut(s)	178, 310
Hpy8I	GTNNAC	1 cut(s)	135
HpyAV	CCTTC	3 cut(s)	20, 50, 379
HpyCH4III	ACNGT	1 cut(s)	458
HpyCH4V	TGCA	3 cut(s)	4, 29, 329
HpyF3I	CTNAG	2 cut(s)	108, 546
Hsp92II	CATG	6 cut(s)	82, 292, 363, 483, 520, 531
Kzo9I	GATC	2 cut(s)	81, 563
LpnPI	CCDG	5 cut(s)	15, 222, 290, 533, 553
Lsp1109I	GCAGC	2 cut(s)	313, 617
LweI	GCATC	1 cut(s)	293
MaeI	CTAG	1 cut(s)	465
MalI	GATC	2 cut(s)	83, 565
MboI	GATC	2 cut(s)	81, 563
MflI	RGATCY	1 cut(s)	563
MluCI	AATT	5 cut(s)	162, 217, 332, 380, 660
MnlI	CCTC	9 cut(s)	267, 276, 317, 443, 480, 488, 510, 513, 550
MroXI	GAANNNNTTC	1 cut(s)	60
MseI	TTAA	2 cut(s)	189, 393
MslI	CAYNNNNRTG	1 cut(s)	301
MspI	CCGG	1 cut(s)	540
MspR9I	CCNGG	1 cut(s)	540
NciI	CCSGG	1 cut(s)	540
NdeI	CATATG	1 cut(s)	298
NdeII	GATC	2 cut(s)	81, 563
NlaIII	CATG	6 cut(s)	82, 292, 363, 483, 520, 531
NlaIV	GGNNCC	1 cut(s)	565
NspI	RCATGY	3 cut(s)	363, 483, 531
PaeI	GCATGC	1 cut(s)	483
PdmI	GAANNNNTTC	1 cut(s)	60
PfeI	GAWTC	1 cut(s)	589
PkrI	GCNGC	4 cut(s)	325, 328, 533, 607
PpuMI	RGGWCCY	1 cut(s)	497
Psp5II	RGGWCCY	1 cut(s)	497
PspN4I	GGNNCC	1 cut(s)	565
PspPI	GGNCC	2 cut(s)	239, 497
PspPPI	RGGWCCY	1 cut(s)	497
PstI	CTGCAG	1 cut(s)	31
PsuI	RGATCY	1 cut(s)	563
RseI	CAYNNNNRTG	1 cut(s)	301
SaqAI	TTAA	2 cut(s)	189, 393
SatI	GCNGC	4 cut(s)	324, 327, 532, 606
Sau3AI	GATC	2 cut(s)	81, 563
Sau96I	GGNCC	2 cut(s)	239, 497
ScrFI	CCNGG	1 cut(s)	540
SetI	ASST	8 cut(s)	25, 61, 105, 317, 435, 499, 552, 625
SfaNI	GCATC	1 cut(s)	293
SfcI	CTRYAG	2 cut(s)	27, 168
SinI	GGWCC	1 cut(s)	497
SmiMI	CAYNNNNRTG	1 cut(s)	301
SpeI	ACTAGT	1 cut(s)	464
SphI	GCATGC	1 cut(s)	483
Sse9I	AATT	5 cut(s)	162, 217, 332, 380, 660
SsiI	CCGC	5 cut(s)	210, 214, 323, 531, 656
SspMI	CTAG	1 cut(s)	465
StyD4I	CCNGG	1 cut(s)	538
StyI	CCWWGG	1 cut(s)	205
TaaI	ACNGT	1 cut(s)	458
TaqI	TCGA	2 cut(s)	84, 311
TasI	AATT	5 cut(s)	162, 217, 332, 380, 660
TauI	GCSGC	2 cut(s)	326, 534
TfiI	GAWTC	1 cut(s)	589
Tru1I	TTAA	2 cut(s)	189, 393
Tru9I	TTAA	2 cut(s)	189, 393
TscAI	CASTG	2 cut(s)	241, 604
TseI	GCWGC	2 cut(s)	326, 605
TspDTI	ATGAA	2 cut(s)	69, 258
TspGWI	ACGGA	2 cut(s)	507, 656
TspRI	CASTG	2 cut(s)	241, 604
VpaK11BI	GGWCC	1 cut(s)	497
XapI	RAATTY	1 cut(s)	217
XceI	RCATGY	3 cut(s)	363, 483, 531
XmnI	GAANNNNTTC	1 cut(s)	60
XspI	CTAG	1 cut(s)	465

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.