Rmu_sc0013032.1_g000004

microtubule nucleation by microtubule organizing center

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013032.1
Physical Location & Seq
Reverse (-)
25674 .. 31650
5977 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013032.1_g000004.1.cds

Sequence Viewer

Length: 939 bp
atggaattagcagactgggcagatttgtttattatgtccctttggcatcataaatggagtattacgcaggcagatcatagactttccgaaattcaaagttttcttgagtcatcagttcagaggtcatcatgtgaacgtgatcataataaggacaggttatttgtgtacctgaaaggacatgatgcagtgcctctttcagcatctgctattggagtccattccttcaactttctaggtttgggatatcgagtggactggcccatcagcattgttttgactcctgctgcattgaaaatatatgccgagatattcagtttcttgatacaagtgaaacttgctctgttttcattgactgacgtgtggtgccaattgaaggatctggtccagttgattagtcggaataaccactctgagcaacatgaaaaggaagtgagtcatttcaatgcaatggtgaaaatgaggcatcaggtcaatcactttgtatctacattacagcaatatgtggagtcacagctatcacatgtatcatggtgcaggtttctatattcacttaagcataaggtcaaagatatgatggatcttcagtcagtgcacatggcatatctctcagattcacttcacatatgtttcctatctgatgaaacaagacctatagcttgcatcattgagagcattctgcagtgtgctctggacttcaggtcttgtctcactggggaagtatggaatgcaggaacaggtcaagggaatttaattgcaagacactctggaatcaatatatcccaggttctttccataaagcaaacgtttgacaaaaatatgaaagaattgcacttgtgttacctcagatcaccgaaacatggcgagtttggactctctcacttctgggaatacctgaactacaacaaatattactcagatgctgcttccaaagctctgtga

Protein Analysis

312

Amino Acids

36.04

Weight (kDa)

6.82

Isoelectric Point (pI)

42.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 525
AccB1I GGYRCC 1 cut(s) 363
AclI AACGTT 1 cut(s) 803
AclWI GGATC 2 cut(s) 384, 585
AcsI RAATTY 2 cut(s) 90, 745
AcuI CTGAAG 2 cut(s) 566, 679
AfaI GTAC 1 cut(s) 167
AfiI CCNNNNNNNGG 2 cut(s) 373, 857
AflII CTTAAG 1 cut(s) 551
AflIII ACRYGT 2 cut(s) 357, 520
AgsI TTSAA 5 cut(s) 95, 226, 292, 373, 442
AhdI GACNNNNNGTC 1 cut(s) 697
AjiI CACGTC 1 cut(s) 358
AjnI CCWGG 1 cut(s) 780
AluBI AGCT 3 cut(s) 514, 656, 932
AluI AGCT 3 cut(s) 514, 656, 932
Alw21I GWGCWC 2 cut(s) 594, 688
Alw26I GTCTC 1 cut(s) 710
Alw44I GTGCAC 1 cut(s) 590
AlwI GGATC 2 cut(s) 384, 585
AlwNI CAGNNNCTG 2 cut(s) 203, 920
AoxI GGCC 1 cut(s) 257
ApaLI GTGCAC 1 cut(s) 590
ApeKI GCWGC 2 cut(s) 284, 920
ApoI RAATTY 2 cut(s) 90, 745
ArsI GACNNNNNNTTYG 2 cut(s) 143, 175
AspS9I GGNCC 2 cut(s) 258, 382
AsuHPI GGTGA 2 cut(s) 463, 840
AvaII GGWCC 1 cut(s) 382
BaeGI GKGCMC 1 cut(s) 594
BanI GGYRCC 1 cut(s) 363
Bbv12I GWGCWC 2 cut(s) 594, 688
BbvI GCAGC 2 cut(s) 271, 907
BccI CCATC 2 cut(s) 269, 568
BciT130I CCWGG 1 cut(s) 782
BclI TGATCA 1 cut(s) 139
BcoDI GTCTC 1 cut(s) 710
BfaI CTAG 1 cut(s) 233
BfmI CTRYAG 2 cut(s) 651, 677
BfrI CTTAAG 1 cut(s) 551
BfuAI ACCTGC 1 cut(s) 525
BisI GCNGC 2 cut(s) 285, 921
BlsI GCNGC 2 cut(s) 286, 922
Bme1390I CCNGG 1 cut(s) 782
Bme18I GGWCC 1 cut(s) 382
BmeRI GACNNNNNGTC 1 cut(s) 697
BmgBI CACGTC 1 cut(s) 358
BmgT120I GGNCC 2 cut(s) 258, 382
BmiI GGNNCC 1 cut(s) 365
BmrFI CCNGG 1 cut(s) 782
BmrI ACTGGG 2 cut(s) 25, 720
BmsI GCATC 6 cut(s) 55, 172, 209, 472, 669, 907
BmuI ACTGGG 2 cut(s) 25, 720
BpuEI CTTGAG 1 cut(s) 125
BsaJI CCNNGG 1 cut(s) 780
Bsc4I CCNNNNNNNGG 2 cut(s) 373, 857
Bse1I ACTGG 4 cut(s) 20, 260, 385, 715
Bse3DI GCAATG 1 cut(s) 453
BseBI CCWGG 1 cut(s) 782
BseDI CCNNGG 1 cut(s) 780
BseLI CCNNNNNNNGG 2 cut(s) 373, 857
BseMI GCAATG 1 cut(s) 453
BseMII CTCAG 4 cut(s) 402, 621, 856, 927
BseNI ACTGG 4 cut(s) 20, 260, 385, 715
BseSI GKGCMC 1 cut(s) 594
BseXI GCAGC 2 cut(s) 271, 907
BsgI GTGCAG 1 cut(s) 553
BshFI GGCC 1 cut(s) 259
BshNI GGYRCC 1 cut(s) 363
BsiHKAI GWGCWC 2 cut(s) 594, 688
BslFI GGGAC 1 cut(s) 22
BslI CCNNNNNNNGG 2 cut(s) 373, 857
BsmAI GTCTC 1 cut(s) 710
BsmFI GGGAC 1 cut(s) 22
BsmI GAATGC 2 cut(s) 672, 730
BsnI GGCC 1 cut(s) 259
Bsp1286I GDGCHC 2 cut(s) 594, 688
Bsp143I GATC 5 cut(s) 73, 139, 376, 577, 845
BspANI GGCC 1 cut(s) 259
BspCNI CTCAG 4 cut(s) 403, 620, 855, 926
BspLI GGNNCC 1 cut(s) 365
BspMAI CTGCAG 1 cut(s) 681
BspMI ACCTGC 1 cut(s) 525
BspPI GGATC 2 cut(s) 384, 585
BspT107I GGYRCC 1 cut(s) 363
BspTI CTTAAG 1 cut(s) 551
BsrDI GCAATG 1 cut(s) 453
BsrI ACTGG 4 cut(s) 20, 260, 385, 715
BssECI CCNNGG 1 cut(s) 780
BssMI GATC 5 cut(s) 73, 139, 376, 577, 845
Bst2UI CCWGG 1 cut(s) 782
BstAFI CTTAAG 1 cut(s) 551
BstC8I GCNNGC 2 cut(s) 69, 658
BstDEI CTNAG 4 cut(s) 411, 607, 842, 913
BstKTI GATC 5 cut(s) 76, 142, 379, 580, 848
BstMAI GTCTC 1 cut(s) 710
BstMBI GATC 5 cut(s) 73, 139, 376, 577, 845
BstMWI GCNNNNNNNGC 2 cut(s) 17, 929
BstNI CCWGG 1 cut(s) 782
BstNSI RCATGY 1 cut(s) 524
BstSCI CCNGG 1 cut(s) 780
BstSFI CTRYAG 2 cut(s) 651, 677
BstSLI GKGCMC 1 cut(s) 594
BstV1I GCAGC 2 cut(s) 271, 907
BstX2I RGATCY 2 cut(s) 376, 577
BstYI RGATCY 2 cut(s) 376, 577
BsuRI GGCC 1 cut(s) 259
BtrI CACGTC 1 cut(s) 358
BtsI GCAGTG 2 cut(s) 192, 686
BtsIMutI CAGTG 4 cut(s) 192, 594, 686, 708
BveI ACCTGC 1 cut(s) 525
Cac8I GCNNGC 2 cut(s) 69, 658
CaiI CAGNNNCTG 2 cut(s) 203, 920
Cfr13I GGNCC 2 cut(s) 258, 382
Csp6I GTAC 1 cut(s) 166
CviAII CATG 7 cut(s) 129, 179, 419, 521, 528, 595, 857
CviJI RGCY 4 cut(s) 259, 514, 656, 932
CviKI_1 RGCY 4 cut(s) 259, 514, 656, 932
CviQI GTAC 1 cut(s) 166
DdeI CTNAG 4 cut(s) 411, 607, 842, 913
DpnI GATC 5 cut(s) 75, 141, 378, 579, 847
DpnII GATC 5 cut(s) 73, 139, 376, 577, 845
DriI GACNNNNNGTC 1 cut(s) 697
Eam1105I GACNNNNNGTC 1 cut(s) 697
Eco32I GATATC 1 cut(s) 245
Eco47I GGWCC 1 cut(s) 382
Eco57I CTGAAG 2 cut(s) 566, 679
EcoRII CCWGG 1 cut(s) 780
EcoRV GATATC 1 cut(s) 245
FaeI CATG 7 cut(s) 132, 182, 422, 524, 531, 598, 860
FalI AAGNNNNNCTT 2 cut(s) 318, 350
FaqI GGGAC 1 cut(s) 22
FatI CATG 7 cut(s) 128, 178, 418, 520, 527, 594, 856
FauNDI CATATG 1 cut(s) 623
FbaI TGATCA 1 cut(s) 139
Fnu4HI GCNGC 2 cut(s) 285, 921
Fsp4HI GCNGC 2 cut(s) 285, 921
FspBI CTAG 1 cut(s) 233
GluI GCNGC 2 cut(s) 285, 921
HaeIII GGCC 1 cut(s) 259
Hin1II CATG 7 cut(s) 132, 182, 422, 524, 531, 598, 860
HinfI GANTC 8 cut(s) 107, 213, 277, 433, 506, 611, 768, 870
HphI GGTGA 2 cut(s) 463, 840
Hpy166II GTNNAC 4 cut(s) 134, 166, 253, 592
Hpy188I TCNGA 8 cut(s) 88, 120, 399, 412, 610, 637, 845, 916
Hpy188III TCNNGA 4 cut(s) 104, 319, 689, 765
Hpy8I GTNNAC 4 cut(s) 134, 166, 253, 592
HpyAV CCTTC 2 cut(s) 232, 367
HpyCH4IV ACGT 3 cut(s) 136, 357, 803
HpyF10VI GCNNNNNNNGC 2 cut(s) 17, 929
HpyF3I CTNAG 4 cut(s) 411, 607, 842, 913
HpySE526I ACGT 3 cut(s) 136, 357, 803
Hsp92II CATG 7 cut(s) 132, 182, 422, 524, 531, 598, 860
Ksp22I TGATCA 1 cut(s) 139
Kzo9I GATC 5 cut(s) 73, 139, 376, 577, 845
Lsp1109I GCAGC 2 cut(s) 271, 907
LweI GCATC 6 cut(s) 55, 172, 209, 472, 669, 907
MaeI CTAG 1 cut(s) 233
MaeII ACGT 3 cut(s) 136, 357, 803
MaeIII GTNAC 2 cut(s) 507, 836
MalI GATC 5 cut(s) 75, 141, 378, 579, 847
MboI GATC 5 cut(s) 73, 139, 376, 577, 845
MboII GAAGA 1 cut(s) 572
MfeI CAATTG 1 cut(s) 368
MflI RGATCY 2 cut(s) 376, 577
MhlI GDGCHC 2 cut(s) 594, 688
MluCI AATT 6 cut(s) 5, 90, 368, 745, 750, 824
MlyI GAGTC 6 cut(s) 116, 222, 271, 442, 515, 864
MmeI TCCRAC 1 cut(s) 377
MnlI CCTC 4 cut(s) 114, 201, 453, 851
MseI TTAA 2 cut(s) 552, 749
MslI CAYNNNNRTG 1 cut(s) 441
MspCI CTTAAG 1 cut(s) 551
MspR9I CCNGG 1 cut(s) 782
MunI CAATTG 1 cut(s) 368
Mva1269I GAATGC 2 cut(s) 672, 730
MvaI CCWGG 1 cut(s) 782
MwoI GCNNNNNNNGC 2 cut(s) 17, 929
NdeI CATATG 1 cut(s) 623
NdeII GATC 5 cut(s) 73, 139, 376, 577, 845
NlaIII CATG 7 cut(s) 132, 182, 422, 524, 531, 598, 860
NlaIV GGNNCC 1 cut(s) 365
NmeAIII GCCGAG 1 cut(s) 328
NmuCI GTSAC 1 cut(s) 507
NspI RCATGY 1 cut(s) 524
PciI ACATGT 1 cut(s) 520
PctI GAATGC 2 cut(s) 672, 730
PfeI GAWTC 2 cut(s) 611, 768
PkrI GCNGC 2 cut(s) 286, 922
PleI GAGTC 6 cut(s) 115, 221, 271, 441, 514, 864
PpsI GAGTC 6 cut(s) 115, 221, 271, 441, 514, 864
PscI ACATGT 1 cut(s) 520
Psp1406I AACGTT 1 cut(s) 803
Psp6I CCWGG 1 cut(s) 780
PspGI CCWGG 1 cut(s) 780
PspN4I GGNNCC 1 cut(s) 365
PspPI GGNCC 2 cut(s) 258, 382
PstI CTGCAG 1 cut(s) 681
PstNI CAGNNNCTG 2 cut(s) 203, 920
PsuI RGATCY 2 cut(s) 376, 577
RsaI GTAC 1 cut(s) 167
RsaNI GTAC 1 cut(s) 166
RseI CAYNNNNRTG 1 cut(s) 441
SaqAI TTAA 2 cut(s) 552, 749
SatI GCNGC 2 cut(s) 285, 921
Sau3AI GATC 5 cut(s) 73, 139, 376, 577, 845
Sau96I GGNCC 2 cut(s) 258, 382
SchI GAGTC 6 cut(s) 116, 222, 271, 442, 515, 864
ScrFI CCNGG 1 cut(s) 782
SduI GDGCHC 2 cut(s) 594, 688
SfaNI GCATC 6 cut(s) 55, 172, 209, 472, 669, 907
SfcI CTRYAG 2 cut(s) 651, 677
SinI GGWCC 1 cut(s) 382
SmiMI CAYNNNNRTG 1 cut(s) 441
SmlI CTYRAG 2 cut(s) 104, 551
SmoI CTYRAG 2 cut(s) 104, 551
Sse9I AATT 6 cut(s) 5, 90, 368, 745, 750, 824
SspI AATATT 1 cut(s) 908
SspMI CTAG 1 cut(s) 233
StyD4I CCNGG 1 cut(s) 780
TaiI ACGT 3 cut(s) 139, 360, 806
TaqI TCGA 1 cut(s) 247
TasI AATT 6 cut(s) 5, 90, 368, 745, 750, 824
TfiI GAWTC 2 cut(s) 611, 768
Tru1I TTAA 2 cut(s) 552, 749
Tru9I TTAA 2 cut(s) 552, 749
TscAI CASTG 4 cut(s) 192, 594, 686, 715
TseFI GTSAC 1 cut(s) 507
TseI GCWGC 2 cut(s) 284, 920
Tsp45I GTSAC 1 cut(s) 507
TspDTI ATGAA 4 cut(s) 336, 435, 654, 833
TspRI CASTG 4 cut(s) 192, 594, 686, 715
Vha464I CTTAAG 1 cut(s) 551
VneI GTGCAC 1 cut(s) 590
VpaK11BI GGWCC 1 cut(s) 382
XapI RAATTY 2 cut(s) 90, 745
XceI RCATGY 1 cut(s) 524
XspI CTAG 1 cut(s) 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.