Rmu_sc0014196.1_g000006

Ribonuclease P MRP protein subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014196.1
Physical Location & Seq
Forward (+)
21200 .. 22233
1034 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014196.1_g000006.1.cds

Sequence Viewer

Length: 465 bp
atggtgggatttaaaaataggtacatgacattggaggttatcttggatccgaataaagaacttgcaaagaaagatccagttatcattaccacatataatgttacaaaagccatcaaagatagcattcttgtgaactttggggagtgtggtctggcttcttcacttggttcgttccaagtgaagtatgtcaatgagattacaaggctttgtatcataagagcttcaagggaggaccatcaaaaagtatggtctgctattaccatggtcaggagtattgctgattgcccggtgatttttaatttgttggacttaagtggaagtatcagagcttgtaaaacagctgccttgaagtgtgatgaattaaaatttgagcagcacaaacttgtggttggatctattctttcagctcaagatactcaaaagatgcagttctatcttgataagatcaaaggcttggagcactaa

Protein Analysis

154

Amino Acids

17.33

Weight (kDa)

8.79

Isoelectric Point (pI)

32.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 41, 54, 68, 400
AcsI RAATTY 1 cut(s) 365
AfaI GTAC 1 cut(s) 23
AfiI CCNNNNNNNGG 1 cut(s) 267
AflII CTTAAG 1 cut(s) 310
AgsI TTSAA 2 cut(s) 225, 349
AluBI AGCT 4 cut(s) 221, 329, 341, 407
AluI AGCT 4 cut(s) 221, 329, 341, 407
Alw21I GWGCWC 1 cut(s) 462
AlwI GGATC 4 cut(s) 41, 54, 68, 400
ApeKI GCWGC 2 cut(s) 341, 373
ApoI RAATTY 1 cut(s) 365
AspS9I GGNCC 1 cut(s) 232
AsuC2I CCSGG 1 cut(s) 287
AsuHPI GGTGA 1 cut(s) 301
AvaII GGWCC 1 cut(s) 232
BamHI GGATCC 1 cut(s) 46
Bbv12I GWGCWC 1 cut(s) 462
BbvI GCAGC 2 cut(s) 328, 385
BccI CCATC 2 cut(s) 119, 243
BcnI CCSGG 1 cut(s) 287
BfrI CTTAAG 1 cut(s) 310
BisI GCNGC 2 cut(s) 342, 374
BlsI GCNGC 2 cut(s) 343, 375
Bme1390I CCNGG 1 cut(s) 287
Bme18I GGWCC 1 cut(s) 232
BmgT120I GGNCC 1 cut(s) 232
BmiI GGNNCC 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 287
BmsI GCATC 1 cut(s) 414
BpuEI CTTGAG 1 cut(s) 393
BpuMI CCSGG 1 cut(s) 287
BsaJI CCNNGG 1 cut(s) 261
Bsc4I CCNNNNNNNGG 1 cut(s) 267
Bse1I ACTGG 1 cut(s) 77
BseDI CCNNGG 1 cut(s) 261
BseLI CCNNNNNNNGG 1 cut(s) 267
BseNI ACTGG 1 cut(s) 77
BseXI GCAGC 2 cut(s) 328, 385
BsiHKAI GWGCWC 1 cut(s) 462
BsiSI CCGG 1 cut(s) 287
BslI CCNNNNNNNGG 1 cut(s) 267
BsmI GAATGC 1 cut(s) 123
Bsp1286I GDGCHC 1 cut(s) 462
Bsp143I GATC 4 cut(s) 46, 73, 392, 444
Bsp19I CCATGG 1 cut(s) 261
BspLI GGNNCC 1 cut(s) 48
BspPI GGATC 4 cut(s) 41, 54, 68, 400
BspTI CTTAAG 1 cut(s) 310
BsrI ACTGG 1 cut(s) 77
BssECI CCNNGG 1 cut(s) 261
BssMI GATC 4 cut(s) 46, 73, 392, 444
BssT1I CCWWGG 1 cut(s) 261
BstAFI CTTAAG 1 cut(s) 310
BstDSI CCRYGG 1 cut(s) 261
BstKTI GATC 4 cut(s) 49, 76, 395, 447
BstMBI GATC 4 cut(s) 46, 73, 392, 444
BstSCI CCNGG 1 cut(s) 285
BstV1I GCAGC 2 cut(s) 328, 385
BstX2I RGATCY 3 cut(s) 46, 73, 392
BstYI RGATCY 3 cut(s) 46, 73, 392
BtgI CCRYGG 1 cut(s) 261
Cfr13I GGNCC 1 cut(s) 232
Csp6I GTAC 1 cut(s) 22
CviAII CATG 2 cut(s) 25, 262
CviJI RGCY 8 cut(s) 110, 155, 205, 221, 329, 341, 407, 453
CviKI_1 RGCY 8 cut(s) 110, 155, 205, 221, 329, 341, 407, 453
CviQI GTAC 1 cut(s) 22
DpnI GATC 4 cut(s) 48, 75, 394, 446
DpnII GATC 4 cut(s) 46, 73, 392, 444
DraI TTTAAA 1 cut(s) 13
Eco130I CCWWGG 1 cut(s) 261
Eco47I GGWCC 1 cut(s) 232
EcoT14I CCWWGG 1 cut(s) 261
ErhI CCWWGG 1 cut(s) 261
FaeI CATG 2 cut(s) 28, 265
FaiI YATR 7 cut(s) 26, 94, 96, 186, 215, 247, 263
FatI CATG 2 cut(s) 24, 261
Fnu4HI GCNGC 2 cut(s) 342, 374
Fsp4HI GCNGC 2 cut(s) 342, 374
GluI GCNGC 2 cut(s) 342, 374
HapII CCGG 1 cut(s) 287
Hin1II CATG 2 cut(s) 28, 265
HpaII CCGG 1 cut(s) 287
HphI GGTGA 1 cut(s) 301
Hpy166II GTNNAC 1 cut(s) 133
Hpy188I TCNGA 2 cut(s) 51, 326
Hpy188III TCNNGA 3 cut(s) 268, 410, 437
Hpy8I GTNNAC 1 cut(s) 133
HpyCH4V TGCA 2 cut(s) 65, 427
Hsp92II CATG 2 cut(s) 28, 265
Kzo9I GATC 4 cut(s) 46, 73, 392, 444
LmnI GCTCC 1 cut(s) 457
LpnPI CCDG 4 cut(s) 90, 137, 253, 300
Lsp1109I GCAGC 2 cut(s) 328, 385
LweI GCATC 1 cut(s) 414
MaeIII GTNAC 1 cut(s) 100
MalI GATC 4 cut(s) 48, 75, 394, 446
MboI GATC 4 cut(s) 46, 73, 392, 444
MboII GAAGA 1 cut(s) 150
MflI RGATCY 3 cut(s) 46, 73, 392
MhlI GDGCHC 1 cut(s) 462
MluCI AATT 3 cut(s) 298, 359, 365
MmeI TCCRAC 2 cut(s) 285, 370
MnlI CCTC 2 cut(s) 28, 223
MseI TTAA 4 cut(s) 12, 297, 311, 362
MslI CAYNNNNRTG 1 cut(s) 128
MspA1I CMGCKG 1 cut(s) 341
MspCI CTTAAG 1 cut(s) 310
MspI CCGG 1 cut(s) 287
MspR9I CCNGG 1 cut(s) 287
Mva1269I GAATGC 1 cut(s) 123
NciI CCSGG 1 cut(s) 287
NcoI CCATGG 1 cut(s) 261
NdeII GATC 4 cut(s) 46, 73, 392, 444
NlaIII CATG 2 cut(s) 28, 265
NlaIV GGNNCC 1 cut(s) 48
PctI GAATGC 1 cut(s) 123
PkrI GCNGC 2 cut(s) 343, 375
PspN4I GGNNCC 1 cut(s) 48
PspPI GGNCC 1 cut(s) 232
PsuI RGATCY 3 cut(s) 46, 73, 392
PvuII CAGCTG 1 cut(s) 341
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
RseI CAYNNNNRTG 1 cut(s) 128
SaqAI TTAA 4 cut(s) 12, 297, 311, 362
SatI GCNGC 2 cut(s) 342, 374
Sau3AI GATC 4 cut(s) 46, 73, 392, 444
Sau96I GGNCC 1 cut(s) 232
ScrFI CCNGG 1 cut(s) 287
SduI GDGCHC 1 cut(s) 462
SetI ASST 6 cut(s) 23, 39, 223, 331, 343, 409
SfaNI GCATC 1 cut(s) 414
SinI GGWCC 1 cut(s) 232
SmiMI CAYNNNNRTG 1 cut(s) 128
SmlI CTYRAG 2 cut(s) 310, 408
SmoI CTYRAG 2 cut(s) 310, 408
Sse9I AATT 3 cut(s) 298, 359, 365
StyD4I CCNGG 1 cut(s) 285
StyI CCWWGG 1 cut(s) 261
TasI AATT 3 cut(s) 298, 359, 365
Tru1I TTAA 4 cut(s) 12, 297, 311, 362
Tru9I TTAA 4 cut(s) 12, 297, 311, 362
TseI GCWGC 2 cut(s) 341, 373
TspDTI ATGAA 1 cut(s) 372
Vha464I CTTAAG 1 cut(s) 310
VpaK11BI GGWCC 1 cut(s) 232
XapI RAATTY 1 cut(s) 365
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.