Rmu_sc0031164.1_g000002

Ribonuclease P MRP protein subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031164.1
Physical Location & Seq
Forward (+)
3819 .. 4854
1036 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031164.1_g000002.1.cds

Sequence Viewer

Length: 465 bp
atggtgggatttaaaaataggtacatgacattggaggttatcttggatccgaatatagaacttgcaaagaaagatcatgttatcattaccacatataatgttacaaaagccatcaaggatagcattcttgtgaactttggggagtgtggtctggcttcttcacttggatcgttccaagtgaagtatgtcaatgggattacaaggctttgtatcataagagcttcgagggaggaccatcaaaaagtatggtctgctattaccatggttaggagtattgctggttgcccggtgatttttaatttgttggacttaactggaagtatcagagcttgtaaaatagctgccttgaagtgtgatgaattaaaatttgagcagtacaaacttgtggttagatctaatctttcagctcaagatactcaaaagatgcagttctatcttgataagatcaaatgcttggagcactaa

Protein Analysis

154

Amino Acids

17.42

Weight (kDa)

9.04

Isoelectric Point (pI)

33.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 41, 54, 175
AcsI RAATTY 1 cut(s) 365
AfaI GTAC 2 cut(s) 23, 377
AfiI CCNNNNNNNGG 1 cut(s) 267
AgsI TTSAA 1 cut(s) 349
AluBI AGCT 4 cut(s) 221, 329, 341, 407
AluI AGCT 4 cut(s) 221, 329, 341, 407
Alw21I GWGCWC 1 cut(s) 462
AlwI GGATC 3 cut(s) 41, 54, 175
ApeKI GCWGC 1 cut(s) 341
ApoI RAATTY 1 cut(s) 365
AspS9I GGNCC 1 cut(s) 232
AsuC2I CCSGG 1 cut(s) 287
AsuHPI GGTGA 1 cut(s) 301
AvaII GGWCC 1 cut(s) 232
BamHI GGATCC 1 cut(s) 46
Bbv12I GWGCWC 1 cut(s) 462
BbvI GCAGC 1 cut(s) 328
BccI CCATC 2 cut(s) 119, 243
BcnI CCSGG 1 cut(s) 287
BglII AGATCT 1 cut(s) 392
BisI GCNGC 1 cut(s) 342
BlsI GCNGC 1 cut(s) 343
Bme1390I CCNGG 1 cut(s) 287
Bme18I GGWCC 1 cut(s) 232
BmgT120I GGNCC 1 cut(s) 232
BmiI GGNNCC 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 287
BmsI GCATC 1 cut(s) 414
BpuEI CTTGAG 1 cut(s) 393
BpuMI CCSGG 1 cut(s) 287
BsaJI CCNNGG 1 cut(s) 261
Bsc4I CCNNNNNNNGG 1 cut(s) 267
Bse1I ACTGG 1 cut(s) 319
BseDI CCNNGG 1 cut(s) 261
BseLI CCNNNNNNNGG 1 cut(s) 267
BseNI ACTGG 1 cut(s) 319
BseXI GCAGC 1 cut(s) 328
BsiHKAI GWGCWC 1 cut(s) 462
BsiSI CCGG 1 cut(s) 287
BslI CCNNNNNNNGG 1 cut(s) 267
BsmI GAATGC 1 cut(s) 123
Bsp1286I GDGCHC 1 cut(s) 462
Bsp143I GATC 5 cut(s) 46, 73, 167, 392, 444
Bsp19I CCATGG 1 cut(s) 261
BspLI GGNNCC 1 cut(s) 48
BspPI GGATC 3 cut(s) 41, 54, 175
BsrI ACTGG 1 cut(s) 319
BssECI CCNNGG 1 cut(s) 261
BssMI GATC 5 cut(s) 46, 73, 167, 392, 444
BssT1I CCWWGG 1 cut(s) 261
BstDSI CCRYGG 1 cut(s) 261
BstKTI GATC 5 cut(s) 49, 76, 170, 395, 447
BstMBI GATC 5 cut(s) 46, 73, 167, 392, 444
BstSCI CCNGG 1 cut(s) 285
BstV1I GCAGC 1 cut(s) 328
BstX2I RGATCY 2 cut(s) 46, 392
BstYI RGATCY 2 cut(s) 46, 392
BtgI CCRYGG 1 cut(s) 261
Cfr13I GGNCC 1 cut(s) 232
Csp6I GTAC 2 cut(s) 22, 376
CviAII CATG 3 cut(s) 25, 77, 262
CviJI RGCY 7 cut(s) 110, 155, 205, 221, 329, 341, 407
CviKI_1 RGCY 7 cut(s) 110, 155, 205, 221, 329, 341, 407
CviQI GTAC 2 cut(s) 22, 376
DpnI GATC 5 cut(s) 48, 75, 169, 394, 446
DpnII GATC 5 cut(s) 46, 73, 167, 392, 444
DraI TTTAAA 1 cut(s) 13
Eco130I CCWWGG 1 cut(s) 261
Eco47I GGWCC 1 cut(s) 232
EcoT14I CCWWGG 1 cut(s) 261
ErhI CCWWGG 1 cut(s) 261
FaeI CATG 3 cut(s) 28, 80, 265
FaiI YATR 9 cut(s) 26, 56, 78, 94, 96, 186, 215, 247, 263
FatI CATG 3 cut(s) 24, 76, 261
Fnu4HI GCNGC 1 cut(s) 342
Fsp4HI GCNGC 1 cut(s) 342
GluI GCNGC 1 cut(s) 342
HapII CCGG 1 cut(s) 287
Hin1II CATG 3 cut(s) 28, 80, 265
HpaII CCGG 1 cut(s) 287
HphI GGTGA 1 cut(s) 301
Hpy166II GTNNAC 1 cut(s) 133
Hpy188I TCNGA 2 cut(s) 51, 326
Hpy188III TCNNGA 2 cut(s) 410, 437
Hpy8I GTNNAC 1 cut(s) 133
HpyCH4V TGCA 2 cut(s) 65, 427
Hsp92II CATG 3 cut(s) 28, 80, 265
Kzo9I GATC 5 cut(s) 46, 73, 167, 392, 444
LmnI GCTCC 1 cut(s) 457
LpnPI CCDG 4 cut(s) 137, 264, 300, 300
Lsp1109I GCAGC 1 cut(s) 328
LweI GCATC 1 cut(s) 414
MaeIII GTNAC 1 cut(s) 100
MalI GATC 5 cut(s) 48, 75, 169, 394, 446
MboI GATC 5 cut(s) 46, 73, 167, 392, 444
MboII GAAGA 1 cut(s) 150
MflI RGATCY 2 cut(s) 46, 392
MhlI GDGCHC 1 cut(s) 462
MluCI AATT 3 cut(s) 298, 359, 365
MmeI TCCRAC 1 cut(s) 285
MnlI CCTC 3 cut(s) 28, 219, 223
MseI TTAA 4 cut(s) 12, 297, 311, 362
MslI CAYNNNNRTG 1 cut(s) 128
MspI CCGG 1 cut(s) 287
MspR9I CCNGG 1 cut(s) 287
Mva1269I GAATGC 1 cut(s) 123
NciI CCSGG 1 cut(s) 287
NcoI CCATGG 1 cut(s) 261
NdeII GATC 5 cut(s) 46, 73, 167, 392, 444
NlaIII CATG 3 cut(s) 28, 80, 265
NlaIV GGNNCC 1 cut(s) 48
PctI GAATGC 1 cut(s) 123
PkrI GCNGC 1 cut(s) 343
PspN4I GGNNCC 1 cut(s) 48
PspPI GGNCC 1 cut(s) 232
PsuI RGATCY 2 cut(s) 46, 392
RsaI GTAC 2 cut(s) 23, 377
RsaNI GTAC 2 cut(s) 22, 376
RseI CAYNNNNRTG 1 cut(s) 128
SaqAI TTAA 4 cut(s) 12, 297, 311, 362
SatI GCNGC 1 cut(s) 342
Sau3AI GATC 5 cut(s) 46, 73, 167, 392, 444
Sau96I GGNCC 1 cut(s) 232
ScrFI CCNGG 1 cut(s) 287
SduI GDGCHC 1 cut(s) 462
SetI ASST 6 cut(s) 23, 39, 223, 331, 343, 409
SfaNI GCATC 1 cut(s) 414
SinI GGWCC 1 cut(s) 232
SmiMI CAYNNNNRTG 1 cut(s) 128
SmlI CTYRAG 1 cut(s) 408
SmoI CTYRAG 1 cut(s) 408
Sse9I AATT 3 cut(s) 298, 359, 365
StyD4I CCNGG 1 cut(s) 285
StyI CCWWGG 1 cut(s) 261
TaqI TCGA 1 cut(s) 224
TasI AATT 3 cut(s) 298, 359, 365
TatI WGTACW 1 cut(s) 375
Tru1I TTAA 4 cut(s) 12, 297, 311, 362
Tru9I TTAA 4 cut(s) 12, 297, 311, 362
TseI GCWGC 1 cut(s) 341
TspDTI ATGAA 1 cut(s) 372
VpaK11BI GGWCC 1 cut(s) 232
XapI RAATTY 1 cut(s) 365
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.