Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014815.1

Orthogroup ID

OG0005202

Physical Location & Seq

Genomic Coordinates Reverse (-)

31849 .. 33198

Gene Structure 1350 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014815.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1350 bp

atgatcatgggtttcttgaaaaactcacattccgaaaagggtctctctgtttttaccaaaatgagaaggataggcgctgacccaaatgctcgaactttcacagttttggttaaagcttgtattggggtgcctttgcttgatcagatatatggtcagatactgaagtttggacatgagtgtgatgtttatgttactagctcagttattagcgtgtactgtaaattgagagctgtggaatttgctcggagagtgtttgatgaaagtttggataggaatgtggtgtgttggactagtcttgttagtgggtattgtggcaatgggttggttgatgatgcccgtgacttgttcgataaaatgcctgtgagaaatgatgtgtcttacagtgcaatggtttcgggttatgttcagaatgcttgtttcaacaaagctattgatttgtttcgtgatttcaagcgtcgtcgtgcgaatgtgaggttgaaagagtctcttttggttagtattcttaatgcctgtgcttctgtgggtgcattcgaggaagggaagtggatccagatgtatttggatgaccatggttttgagtatggacttgagctcggtacagcaggaatagatttttatgcaaaatgtggatttattaaagatgctaaagagatttttgataggatgccgcgtaaagatgtaactacttggagtgctatgatcatgggatatgctactaatggtgagaatgatacagggcttgaactttttgctgaaatggaaaagaagggacctaaaccaaatgctgtgacatttgttggagttctcactgcatgtaatcacaaaactctggtcaatgaagcatcgcgagtattgggacgtatgagtaaaatttatagcattgctccagagattgagcactatgggtgcatggtcgatctcttggcccgtgctgggcgagtgaaagaggcagagatattgataagaagtatggcaatggaaccagacggagctatatgggggtctttacttaacgggtgtctgatacatggccattttgagttagctggtaagattgggaagcttctcattcaattagagcctcaacatagtggaaggtatgttcttttagcaaatatgtatgccaaaatggaaaagtgggaggatgtgttgaggctaaggaaaatgatgaaggatagagaggtagtttcaatatctgcttggagtttcatcgaggttgatggtgttgtgcataaattcttagccaatgataagtctcattctcattcaagaagtatataccaaacattgagtcaactgaagaacgaactcgaaagtttttccaatgccaatgattctttgctattgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2

Protein Analysis

449

Amino Acids

50.45

Weight (kDa)

7.93

Isoelectric Point (pI)

39.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005202)

Species	Orthologous Gene IDs
malus_domestica	MD04G1188600.v1.1 MD13G1252400.v1.1
prunus_persica	Prupe.1G084600_v2.0.a1
pyrus_communis	pycom13g22560
rosa_chinensis	RchiOBHm_Chr1g0380711 RchiOBHm_Chr3g0484681 RchiOBHm_Chr4g0401751
rosa_laevigata	RLG00000009137 RLG00000023208 RLG00000026276
rosa_multiflora	Rmu_sc0001637.1_g000010 Rmu_sc0014815.1_g000014 Rmu_sc0039959.1_g000001
rosa_roxburghii	Rroxscaffold_2G00113990 Rroxscaffold_4G00279090 Rroxscaffold_5G00345080 Rroxscaffold_5G00353300 Rroxscaffold_6G00397530
rosa_rugosa	Rorug04G0031400
rosa_samantha	Rh1BG403400 Rh1CG417600 Rh1DG433700 Rh3AG263400 Rh3DG292100 Rh4AG108800 Rh4BG102500 Rh4CG117100
rosa_wichuraiana	Rw0G005870 Rw1G038990 Rw4G024940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	127
AccII	CGCG	2 cut(s)	670, 847
AciI	CCGC	1 cut(s)	668
AclWI	GGATC	2 cut(s)	541, 554
AcoI	YGGCCR	1 cut(s)	1030
AcsI	RAATTY	3 cut(s)	236, 870, 1235
AcuI	CTGAAG	2 cut(s)	182, 1319
AfaI	GTAC	2 cut(s)	215, 598
AfiI	CCNNNNNNNGG	1 cut(s)	933
AgsI	TTSAA	8 cut(s)	19, 421, 451, 478, 743, 1073, 1191, 1269
AhlI	ACTAGT	1 cut(s)	290
AloI	GAACNNNNNNTCC	2 cut(s)	1086, 1118
AluBI	AGCT	8 cut(s)	116, 198, 230, 428, 592, 992, 1046, 1063
AluI	AGCT	8 cut(s)	116, 198, 230, 428, 592, 992, 1046, 1063
Alw21I	GWGCWC	2 cut(s)	594, 900
Alw26I	GTCTC	3 cut(s)	47, 489, 1260
AlwI	GGATC	2 cut(s)	541, 554
AlwNI	CAGNNNCTG	1 cut(s)	160
AoxI	GGCC	2 cut(s)	924, 1030
ApoI	RAATTY	3 cut(s)	236, 870, 1235
ArsI	GACNNNNNNTTYG	6 cut(s)	557, 589, 816, 848, 1276, 1308
AspLEI	GCGC	1 cut(s)	77
AspS9I	GGNCC	2 cut(s)	770, 925
AsuHPI	GGTGA	1 cut(s)	734
AvaII	GGWCC	1 cut(s)	770
BaeI	ACNNNNGTAYC	2 cut(s)	149, 182
BalI	TGGCCA	1 cut(s)	1032
BamHI	GGATCC	1 cut(s)	546
BanI	GGYRCC	1 cut(s)	127
BanII	GRGCYC	1 cut(s)	594
Bbv12I	GWGCWC	2 cut(s)	594, 900
BccI	CCATC	1 cut(s)	1214
BcgI	CGANNNNNNTGC	2 cut(s)	375, 409
BclI	TGATCA	3 cut(s)	3, 139, 699
BcoDI	GTCTC	3 cut(s)	47, 489, 1260
BcuI	ACTAGT	1 cut(s)	290
BfaI	CTAG	2 cut(s)	195, 291
BfoI	RGCGCY	1 cut(s)	78
BisI	GCNGC	1 cut(s)	668
BlsI	GCNGC	1 cut(s)	669
Bme18I	GGWCC	1 cut(s)	770
BmgT120I	GGNCC	2 cut(s)	770, 925
BmiI	GGNNCC	4 cut(s)	129, 548, 771, 981
BmsI	GCATC	4 cut(s)	322, 631, 654, 851
BpmI	CTGGAG	1 cut(s)	870
Bpu10I	CCTNAGC	1 cut(s)	1157
BpuEI	CTTGAG	1 cut(s)	608
BsaI	GGTCTC	1 cut(s)	47
BsaJI	CCNNGG	1 cut(s)	568
BsaXI	ACNNNNNCTCC	2 cut(s)	1133, 1163
Bsc4I	CCNNNNNNNGG	1 cut(s)	933
Bse3DI	GCAATG	4 cut(s)	322, 393, 879, 981
BseDI	CCNNGG	1 cut(s)	568
BseGI	GGATG	3 cut(s)	568, 669, 1150
BseLI	CCNNNNNNNGG	1 cut(s)	933
BseMI	GCAATG	4 cut(s)	322, 393, 879, 981
BseMII	CTCAG	1 cut(s)	213
BseYI	CCCAGC	1 cut(s)	932
Bsh1236I	CGCG	2 cut(s)	670, 847
BshFI	GGCC	2 cut(s)	926, 1032
BshNI	GGYRCC	1 cut(s)	127
BsiHKAI	GWGCWC	2 cut(s)	594, 900
BslFI	GGGAC	2 cut(s)	783, 870
BslI	CCNNNNNNNGG	1 cut(s)	933
BsmAI	GTCTC	3 cut(s)	47, 489, 1260
BsmFI	GGGAC	2 cut(s)	783, 870
BsmI	GAATGC	2 cut(s)	415, 527
BsnI	GGCC	2 cut(s)	926, 1032
Bso31I	GGTCTC	1 cut(s)	47
Bsp1286I	GDGCHC	2 cut(s)	594, 900
Bsp143I	GATC	5 cut(s)	3, 139, 546, 699, 916
Bsp19I	CCATGG	1 cut(s)	568
Bsp68I	TCGCGA	1 cut(s)	847
BspACI	CCGC	1 cut(s)	668
BspANI	GGCC	2 cut(s)	926, 1032
BspCNI	CTCAG	1 cut(s)	212
BspFNI	CGCG	2 cut(s)	670, 847
BspLI	GGNNCC	4 cut(s)	129, 548, 771, 981
BspPI	GGATC	2 cut(s)	541, 554
BspT107I	GGYRCC	1 cut(s)	127
BspTNI	GGTCTC	1 cut(s)	47
BsrDI	GCAATG	4 cut(s)	322, 393, 879, 981
BssECI	CCNNGG	1 cut(s)	568
BssMI	GATC	5 cut(s)	3, 139, 546, 699, 916
BssT1I	CCWWGG	1 cut(s)	568
Bst4CI	ACNGT	3 cut(s)	103, 218, 383
BstDEI	CTNAG	3 cut(s)	199, 1157, 1240
BstDSI	CCRYGG	1 cut(s)	568
BstF5I	GGATG	3 cut(s)	568, 669, 1150
BstFNI	CGCG	2 cut(s)	670, 847
BstH2I	RGCGCY	1 cut(s)	78
BstHHI	GCGC	1 cut(s)	77
BstKTI	GATC	5 cut(s)	6, 142, 549, 702, 919
BstMAI	GTCTC	3 cut(s)	47, 489, 1260
BstMBI	GATC	5 cut(s)	3, 139, 546, 699, 916
BstNSI	RCATGY	1 cut(s)	816
BstUI	CGCG	2 cut(s)	670, 847
BstX2I	RGATCY	1 cut(s)	546
BstYI	RGATCY	1 cut(s)	546
BsuRI	GGCC	2 cut(s)	926, 1032
BtgI	CCRYGG	1 cut(s)	568
BtgZI	GCGATG	1 cut(s)	828
BtsCI	GGATG	3 cut(s)	568, 669, 1150
BtsI	GCAGTG	1 cut(s)	807
BtsIMutI	CAGTG	2 cut(s)	388, 807
BtuMI	TCGCGA	1 cut(s)	847
CaiI	CAGNNNCTG	1 cut(s)	160
CfoI	GCGC	1 cut(s)	77
Cfr13I	GGNCC	2 cut(s)	770, 925
CseI	GACGC	1 cut(s)	443
Csp6I	GTAC	2 cut(s)	214, 597
CviAII	CATG	7 cut(s)	7, 173, 569, 703, 813, 910, 1028
CviQI	GTAC	2 cut(s)	214, 597
DdeI	CTNAG	3 cut(s)	199, 1157, 1240
DpnI	GATC	5 cut(s)	5, 141, 548, 701, 918
DpnII	GATC	5 cut(s)	3, 139, 546, 699, 916
EaeI	YGGCCR	1 cut(s)	1030
Ecl136II	GAGCTC	1 cut(s)	592
Eco130I	CCWWGG	1 cut(s)	568
Eco24I	GRGCYC	1 cut(s)	594
Eco31I	GGTCTC	1 cut(s)	47
Eco47I	GGWCC	1 cut(s)	770
Eco53kI	GAGCTC	1 cut(s)	592
Eco57I	CTGAAG	2 cut(s)	182, 1319
EcoICRI	GAGCTC	1 cut(s)	592
EcoO109I	RGGNCCY	1 cut(s)	770
EcoT14I	CCWWGG	1 cut(s)	568
EcoT38I	GRGCYC	1 cut(s)	594
ErhI	CCWWGG	1 cut(s)	568
FaeI	CATG	7 cut(s)	10, 176, 572, 706, 816, 913, 1031
FalI	AAGNNNNNCTT	2 cut(s)	471, 503
FaqI	GGGAC	2 cut(s)	783, 870
FatI	CATG	7 cut(s)	6, 172, 568, 702, 812, 909, 1027
FbaI	TGATCA	3 cut(s)	3, 139, 699
Fnu4HI	GCNGC	1 cut(s)	668
FokI	GGATG	3 cut(s)	575, 676, 1157
FriOI	GRGCYC	1 cut(s)	594
Fsp4HI	GCNGC	1 cut(s)	668
FspBI	CTAG	2 cut(s)	195, 291
GlaI	GCGC	1 cut(s)	76
GluI	GCNGC	1 cut(s)	668
GsaI	CCCAGC	1 cut(s)	936
GsuI	CTGGAG	1 cut(s)	870
HaeII	RGCGCY	1 cut(s)	78
HaeIII	GGCC	2 cut(s)	926, 1032
HgaI	GACGC	1 cut(s)	443
HhaI	GCGC	1 cut(s)	77
Hin1II	CATG	7 cut(s)	10, 176, 572, 706, 816, 913, 1031
Hin6I	GCGC	1 cut(s)	75
HinP1I	GCGC	1 cut(s)	75
HincII	GTYRAC	1 cut(s)	1295
HindII	GTYRAC	1 cut(s)	1295
HindIII	AAGCTT	2 cut(s)	114, 1061
HinfI	GANTC	3 cut(s)	482, 1291, 1334
HphI	GGTGA	1 cut(s)	734
Hpy166II	GTNNAC	2 cut(s)	214, 1295
Hpy188I	TCNGA	6 cut(s)	34, 144, 156, 246, 408, 1023
Hpy188III	TCNNGA	6 cut(s)	16, 443, 550, 846, 887, 1269
Hpy8I	GTNNAC	2 cut(s)	214, 1295
Hpy99I	CGWCG	2 cut(s)	459, 462
HpyAV	CCTTC	5 cut(s)	60, 530, 760, 1089, 1165
HpyCH4III	ACNGT	3 cut(s)	103, 218, 383
HpyCH4IV	ACGT	1 cut(s)	859
HpyCH4V	TGCA	6 cut(s)	386, 527, 620, 812, 909, 1231
HpyF3I	CTNAG	3 cut(s)	199, 1157, 1240
HpySE526I	ACGT	1 cut(s)	859
Hsp92II	CATG	7 cut(s)	10, 176, 572, 706, 816, 913, 1031
HspAI	GCGC	1 cut(s)	75
Ksp22I	TGATCA	3 cut(s)	3, 139, 699
Kzo9I	GATC	5 cut(s)	3, 139, 546, 699, 916
LmnI	GCTCC	2 cut(s)	889, 989
LweI	GCATC	4 cut(s)	322, 631, 654, 851
MaeI	CTAG	2 cut(s)	195, 291
MaeII	ACGT	1 cut(s)	859
MaeIII	GTNAC	4 cut(s)	190, 338, 679, 787
MalI	GATC	5 cut(s)	5, 141, 548, 701, 918
MboI	GATC	5 cut(s)	3, 139, 546, 699, 916
MboII	GAAGA	1 cut(s)	1312
MflI	RGATCY	1 cut(s)	546
MhlI	GDGCHC	2 cut(s)	594, 900
MlsI	TGGCCA	1 cut(s)	1032
MluCI	AATT	5 cut(s)	221, 236, 870, 1073, 1235
MluNI	TGGCCA	1 cut(s)	1032
MlyI	GAGTC	2 cut(s)	491, 1300
MmeI	TCCRAC	2 cut(s)	266, 778
MnlI	CCTC	8 cut(s)	465, 526, 940, 1092, 1135, 1146, 1174, 1207
Mox20I	TGGCCA	1 cut(s)	1032
MscI	TGGCCA	1 cut(s)	1032
MseI	TTAA	4 cut(s)	111, 504, 636, 1011
MslI	CAYNNNNRTG	1 cut(s)	177
Msp20I	TGGCCA	1 cut(s)	1032
Mva1269I	GAATGC	2 cut(s)	415, 527
MvnI	CGCG	2 cut(s)	670, 847
NcoI	CCATGG	1 cut(s)	568
NdeII	GATC	5 cut(s)	3, 139, 546, 699, 916
NlaIII	CATG	7 cut(s)	10, 176, 572, 706, 816, 913, 1031
NlaIV	GGNNCC	4 cut(s)	129, 548, 771, 981
NmuCI	GTSAC	2 cut(s)	338, 787
NruI	TCGCGA	1 cut(s)	847
NspI	RCATGY	1 cut(s)	816
PctI	GAATGC	2 cut(s)	415, 527
PfeI	GAWTC	1 cut(s)	1334
PkrI	GCNGC	1 cut(s)	669
PleI	GAGTC	2 cut(s)	490, 1299
PpsI	GAGTC	2 cut(s)	490, 1299
PpuMI	RGGWCCY	1 cut(s)	770
Psp124BI	GAGCTC	1 cut(s)	594
Psp5II	RGGWCCY	1 cut(s)	770
PspFI	CCCAGC	1 cut(s)	932
PspN4I	GGNNCC	4 cut(s)	129, 548, 771, 981
PspPI	GGNCC	2 cut(s)	770, 925
PspPPI	RGGWCCY	1 cut(s)	770
PstNI	CAGNNNCTG	1 cut(s)	160
PsuI	RGATCY	1 cut(s)	546
RruI	TCGCGA	1 cut(s)	847
RsaI	GTAC	2 cut(s)	215, 598
RsaNI	GTAC	2 cut(s)	214, 597
RseI	CAYNNNNRTG	1 cut(s)	177
SacI	GAGCTC	1 cut(s)	594
SaqAI	TTAA	4 cut(s)	111, 504, 636, 1011
SatI	GCNGC	1 cut(s)	668
Sau3AI	GATC	5 cut(s)	3, 139, 546, 699, 916
Sau96I	GGNCC	2 cut(s)	770, 925
SchI	GAGTC	2 cut(s)	491, 1300
SduI	GDGCHC	2 cut(s)	594, 900
SfaNI	GCATC	4 cut(s)	322, 631, 654, 851
SinI	GGWCC	1 cut(s)	770
SmiMI	CAYNNNNRTG	1 cut(s)	177
SmlI	CTYRAG	1 cut(s)	587
SmoI	CTYRAG	1 cut(s)	587
SpeI	ACTAGT	1 cut(s)	290
Sse9I	AATT	5 cut(s)	221, 236, 870, 1073, 1235
SsiI	CCGC	1 cut(s)	668
SspMI	CTAG	2 cut(s)	195, 291
SstI	GAGCTC	1 cut(s)	594
StyI	CCWWGG	1 cut(s)	568
TaaI	ACNGT	3 cut(s)	103, 218, 383
TaiI	ACGT	1 cut(s)	862
TaqI	TCGA	6 cut(s)	91, 348, 531, 915, 1212, 1311
TasI	AATT	5 cut(s)	221, 236, 870, 1073, 1235
TatI	WGTACW	1 cut(s)	213
TauI	GCSGC	1 cut(s)	670
TfiI	GAWTC	1 cut(s)	1334
Tru1I	TTAA	4 cut(s)	111, 504, 636, 1011
Tru9I	TTAA	4 cut(s)	111, 504, 636, 1011
TscAI	CASTG	2 cut(s)	388, 814
TseFI	GTSAC	2 cut(s)	338, 787
Tsp45I	GTSAC	2 cut(s)	338, 787
TspDTI	ATGAA	4 cut(s)	273, 852, 1184, 1198
TspGWI	ACGGA	1 cut(s)	1002
TspRI	CASTG	2 cut(s)	388, 814
VpaK11BI	GGWCC	1 cut(s)	770
XapI	RAATTY	3 cut(s)	236, 870, 1235
XceI	RCATGY	1 cut(s)	816
XspI	CTAG	2 cut(s)	195, 291

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.