Rmu_sc0015616.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015616.1
OG0014862
Physical Location & Seq
Forward (+)
1691 .. 2077
387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015616.1_g000002.1.cds

Sequence Viewer

Length: 387 bp
atgttagttgcggtgaggaagctgagtgccacgacggcgtggcccgcctccgtcatatctctggcaagctgcacaagaaggtctggattgccgccggccatattctctctctctctgtctgtctctctctctctgatccctttgtctgaaatcttaggtaaattccaagtctcaaatctggaggccaagagtcgtgaaaccgtctacaccgctccggcctgcaataaattcagagaagcaaagacgttgagcaagttgtgcttggagaactccgacgagatagagtccccagcggtgtccgtccatcagagaattggattcaagttttgctttgggttttgcattttgctaggaaacgtcatcaacccatctaattgcattttgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

128

Amino Acids

13.83

Weight (kDa)

9.05

Isoelectric Point (pI)

54.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 212
AccI GTMKAC 1 cut(s) 204
AciI CCGC 5 cut(s) 11, 45, 92, 210, 293
AclWI GGATC 1 cut(s) 130
AcoI YGGCCR 1 cut(s) 96
AcsI RAATTY 2 cut(s) 161, 227
AgsI TTSAA 1 cut(s) 322
AluBI AGCT 2 cut(s) 22, 69
AluI AGCT 2 cut(s) 22, 69
Alw26I GTCTC 2 cut(s) 127, 175
AlwI GGATC 1 cut(s) 130
AoxI GGCC 4 cut(s) 41, 96, 183, 216
ApeKI GCWGC 1 cut(s) 69
ApoI RAATTY 2 cut(s) 161, 227
AspS9I GGNCC 1 cut(s) 42
AsuHPI GGTGA 1 cut(s) 25
BbvI GCAGC 1 cut(s) 56
BccI CCATC 2 cut(s) 312, 376
BceAI ACGGC 1 cut(s) 51
BcoDI GTCTC 2 cut(s) 127, 175
BfaI CTAG 1 cut(s) 350
BglI GCCNNNNNGGC 1 cut(s) 35
BisI GCNGC 2 cut(s) 70, 92
BlsI GCNGC 2 cut(s) 71, 93
BmgT120I GGNCC 1 cut(s) 42
BpmI CTGGAG 1 cut(s) 200
Bse118I RCCGGY 1 cut(s) 94
BseMII CTCAG 1 cut(s) 14
BseXI GCAGC 1 cut(s) 56
BseYI CCCAGC 1 cut(s) 289
BsgI GTGCAG 1 cut(s) 55
BshFI GGCC 4 cut(s) 43, 98, 185, 218
BsiSI CCGG 2 cut(s) 95, 215
BslFI GGGAC 1 cut(s) 271
BsmAI GTCTC 2 cut(s) 127, 175
BsmFI GGGAC 1 cut(s) 271
BsnI GGCC 4 cut(s) 43, 98, 185, 218
Bsp143I GATC 1 cut(s) 135
BspACI CCGC 5 cut(s) 11, 45, 92, 210, 293
BspANI GGCC 4 cut(s) 43, 98, 185, 218
BspCNI CTCAG 1 cut(s) 15
BspPI GGATC 1 cut(s) 130
BsrBI CCGCTC 1 cut(s) 212
BsrFI RCCGGY 1 cut(s) 94
BssAI RCCGGY 1 cut(s) 94
BssMI GATC 1 cut(s) 135
Bst4CI ACNGT 1 cut(s) 202
BstAPI GCANNNNNTGC 1 cut(s) 258
BstC8I GCNNGC 4 cut(s) 45, 67, 96, 220
BstDEI CTNAG 2 cut(s) 23, 154
BstKTI GATC 1 cut(s) 138
BstMAI GTCTC 2 cut(s) 127, 175
BstMBI GATC 1 cut(s) 135
BstMWI GCNNNNNNNGC 3 cut(s) 35, 44, 258
BstV1I GCAGC 1 cut(s) 56
BsuRI GGCC 4 cut(s) 43, 98, 185, 218
Cac8I GCNNGC 4 cut(s) 45, 67, 96, 220
Cfr10I RCCGGY 1 cut(s) 94
Cfr13I GGNCC 1 cut(s) 42
CviJI RGCY 6 cut(s) 22, 43, 69, 98, 185, 218
CviKI_1 RGCY 6 cut(s) 22, 43, 69, 98, 185, 218
DdeI CTNAG 2 cut(s) 23, 154
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
EaeI YGGCCR 1 cut(s) 96
FaiI YATR 2 cut(s) 56, 101
FalI AAGNNNNNCTT 4 cut(s) 245, 277, 314, 346
FaqI GGGAC 1 cut(s) 271
FauI CCCGC 1 cut(s) 52
FblI GTMKAC 1 cut(s) 204
Fnu4HI GCNGC 2 cut(s) 70, 92
Fsp4HI GCNGC 2 cut(s) 70, 92
FspBI CTAG 1 cut(s) 350
GluI GCNGC 2 cut(s) 70, 92
GsaI CCCAGC 1 cut(s) 293
GsuI CTGGAG 1 cut(s) 200
HaeIII GGCC 4 cut(s) 43, 98, 185, 218
HapII CCGG 2 cut(s) 95, 215
HinfI GANTC 3 cut(s) 190, 284, 318
HpaII CCGG 2 cut(s) 95, 215
HphI GGTGA 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 205
Hpy188I TCNGA 5 cut(s) 135, 148, 233, 274, 309
Hpy188III TCNNGA 3 cut(s) 84, 179, 194
Hpy8I GTNNAC 1 cut(s) 205
Hpy99I CGWCG 2 cut(s) 37, 278
HpyAV CCTTC 1 cut(s) 72
HpyCH4III ACNGT 1 cut(s) 202
HpyCH4IV ACGT 2 cut(s) 245, 357
HpyCH4V TGCA 4 cut(s) 72, 222, 342, 378
HpyF10VI GCNNNNNNNGC 3 cut(s) 35, 44, 258
HpyF3I CTNAG 2 cut(s) 23, 154
HpySE526I ACGT 2 cut(s) 245, 357
KroI GCCGGC 1 cut(s) 94
KroNI GCCGGC 1 cut(s) 96
Kzo9I GATC 1 cut(s) 135
LmnI GCTCC 1 cut(s) 217
LpnPI CCDG 7 cut(s) 47, 69, 108, 164, 228, 232, 303
Lsp1109I GCAGC 1 cut(s) 56
MaeI CTAG 1 cut(s) 350
MaeII ACGT 2 cut(s) 245, 357
MalI GATC 1 cut(s) 137
MbiI CCGCTC 1 cut(s) 212
MboI GATC 1 cut(s) 135
MluCI AATT 4 cut(s) 161, 227, 312, 373
MlyI GAGTC 2 cut(s) 199, 293
MmeI TCCRAC 1 cut(s) 297
MnlI CCTC 3 cut(s) 9, 58, 175
MroNI GCCGGC 1 cut(s) 94
MspA1I CMGCKG 1 cut(s) 293
MspI CCGG 2 cut(s) 95, 215
MwoI GCNNNNNNNGC 3 cut(s) 35, 44, 258
NaeI GCCGGC 1 cut(s) 96
NdeII GATC 1 cut(s) 135
NgoMIV GCCGGC 1 cut(s) 94
PdiI GCCGGC 1 cut(s) 96
PfeI GAWTC 1 cut(s) 318
PkrI GCNGC 2 cut(s) 71, 93
PleI GAGTC 2 cut(s) 198, 292
PpsI GAGTC 2 cut(s) 198, 292
PspFI CCCAGC 1 cut(s) 289
PspPI GGNCC 1 cut(s) 42
SatI GCNGC 2 cut(s) 70, 92
Sau3AI GATC 1 cut(s) 135
Sau96I GGNCC 1 cut(s) 42
SchI GAGTC 2 cut(s) 199, 293
SetI ASST 6 cut(s) 24, 71, 83, 160, 248, 360
Sse9I AATT 4 cut(s) 161, 227, 312, 373
SsiI CCGC 5 cut(s) 11, 45, 92, 210, 293
SspMI CTAG 1 cut(s) 350
TaaI ACNGT 1 cut(s) 202
TaiI ACGT 2 cut(s) 248, 360
TasI AATT 4 cut(s) 161, 227, 312, 373
TauI GCSGC 1 cut(s) 94
TfiI GAWTC 1 cut(s) 318
TseI GCWGC 1 cut(s) 69
TspGWI ACGGA 2 cut(s) 40, 289
XapI RAATTY 2 cut(s) 161, 227
XcmI CCANNNNNNNNNTGG 1 cut(s) 311
XmiI GTMKAC 1 cut(s) 204
XspI CTAG 1 cut(s) 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.