Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0015961.1

Orthogroup ID

OG0003639

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1460

Gene Structure 1460 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0015961.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 639 bp

atggctccaaagaacgacggatccacaaaaaaggttatgaacaaaggagcctggactgcagaagaagatagaaaacttgcagagtacattgaaatccatggtgccaagaggtggaagactgtggcttccatagcaggtttgaatcgatgtggaaagagttgcagactgagatggttgaactacctgagaccgaatatcaagagaggaaacatatctggtgatgaagaggacttgatacttcgtcttcataagctacttggaaacaggtggtcgttgattgcggggagactcccaggccgaacagacaatgaaataaagaactactggaattcacatttgagcaagaaaataaagcagaagaatgagaaagctacattggcttcggcagcgcaagagattagtaccactagtactacgaccactactcctccccagaaggcattaaacgagacaagtagtgttccagcagacaaagacgaagaagaacaagtaaagttaggaacaagttcggatggtatcttcgatgtgaacgagttctttgacttctccactgaaggctcgtatgggttggagtgggtgaacaagtttcttgagcttgatgaagaccccatggctgctgcttacagagaaaataataag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

213

Amino Acids

24.02

Weight (kDa)

8.4

Isoelectric Point (pI)

51.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003639)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G66380
fragaria_vesca	FvH4_2g31020 FvH4_2g31020 FvH4_5g19400 FvH4_5g19400 FvH4_5g19400
malus_domestica	MD04G1060200.v1.1 MD06G1053100.v1.1 MD15G1050300.v1.1
prunus_persica	Prupe.1G404700_v2.0.a1 Prupe.1G404800_v2.0.a1 Prupe.5G065500_v2.0.a1
pyrus_communis	pycom04g05380 pycom06g04480 pycom15g04870
rosa_chinensis	RchiOBHm_Chr6g0311771 RchiOBHm_Chr7g0203911
rosa_laevigata	RLG00000003500 RLG00000010375
rosa_multiflora	Rmu_sc0002888.1_g000040 Rmu_sc0014006.1_g000003 Rmu_sc0015961.1_g000001
rosa_roxburghii	Rroxscaffold_3G00253470 Rroxscaffold_7G00157320
rosa_rugosa	Rorug07G0079200.1 Rorug07G0079300
rosa_samantha	Rh6AG506900 Rh6BG517700 Rh6CG523300 Rh6DG509200 Rh7AG209200 Rh7CG221600 Rh7DG216200
rosa_wichuraiana	Rw6G044100 Rw7G018230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	125
AccB1I	GGYRCC	1 cut(s)	101
AccB7I	CCANNNNNTGG	1 cut(s)	111
AciI	CCGC	1 cut(s)	281
AclWI	GGATC	2 cut(s)	15, 28
AcsI	RAATTY	1 cut(s)	328
AcuI	CTGAAG	1 cut(s)	573
AfaI	GTAC	3 cut(s)	86, 403, 412
AfiI	CCNNNNNNNGG	1 cut(s)	111
AgsI	TTSAA	3 cut(s)	92, 142, 178
AhlI	ACTAGT	1 cut(s)	407
AjnI	CCWGG	2 cut(s)	50, 292
AjuI	GAANNNNNNNTTGG	2 cut(s)	359, 391
AloI	GAACNNNNNNTCC	1 cut(s)	37
AluBI	AGCT	3 cut(s)	253, 371, 595
AluI	AGCT	3 cut(s)	253, 371, 595
Alw26I	GTCTC	3 cut(s)	181, 280, 443
AlwI	GGATC	2 cut(s)	15, 28
AoxI	GGCC	1 cut(s)	295
ApeKI	GCWGC	3 cut(s)	386, 614, 617
ApoI	RAATTY	1 cut(s)	328
Asp700I	GAANNNNTTC	2 cut(s)	505, 533
AspLEI	GCGC	1 cut(s)	391
AsuHPI	GGTGA	2 cut(s)	230, 589
BamHI	GGATCC	1 cut(s)	20
BanI	GGYRCC	1 cut(s)	101
BbsI	GAAGAC	3 cut(s)	122, 236, 609
BbvI	GCAGC	3 cut(s)	398, 601, 604
BccI	CCATC	2 cut(s)	165, 506
BciT130I	CCWGG	2 cut(s)	52, 294
BcoDI	GTCTC	3 cut(s)	181, 280, 443
BcuI	ACTAGT	1 cut(s)	407
BfaI	CTAG	1 cut(s)	408
BfmI	CTRYAG	1 cut(s)	57
BfuAI	ACCTGC	1 cut(s)	125
BisI	GCNGC	3 cut(s)	387, 615, 618
BlsI	GCNGC	3 cut(s)	388, 616, 619
BmcAI	AGTACT	1 cut(s)	412
Bme1390I	CCNGG	2 cut(s)	52, 294
BmiI	GGNNCC	4 cut(s)	6, 22, 49, 103
BmrFI	CCNGG	2 cut(s)	52, 294
BpiI	GAAGAC	3 cut(s)	122, 236, 609
BpuEI	CTTGAG	1 cut(s)	611
Bsa29I	ATCGAT	1 cut(s)	145
BsaI	GGTCTC	1 cut(s)	181
BsaJI	CCNNGG	3 cut(s)	97, 292, 609
BsaXI	ACNNNNNCTCC	4 cut(s)	409, 412, 439, 442
Bsc4I	CCNNNNNNNGG	1 cut(s)	111
Bse1I	ACTGG	1 cut(s)	329
BseBI	CCWGG	2 cut(s)	52, 294
BseCI	ATCGAT	1 cut(s)	145
BseDI	CCNNGG	3 cut(s)	97, 292, 609
BseGI	GGATG	1 cut(s)	517
BseLI	CCNNNNNNNGG	1 cut(s)	111
BseMII	CTCAG	2 cut(s)	158, 176
BseNI	ACTGG	1 cut(s)	329
BseRI	GAGGAG	1 cut(s)	417
BseXI	GCAGC	3 cut(s)	398, 601, 604
BshFI	GGCC	1 cut(s)	297
BshNI	GGYRCC	1 cut(s)	101
BshVI	ATCGAT	1 cut(s)	145
BslI	CCNNNNNNNGG	1 cut(s)	111
BsmAI	GTCTC	3 cut(s)	181, 280, 443
BsnI	GGCC	1 cut(s)	297
Bso31I	GGTCTC	1 cut(s)	181
Bsp143I	GATC	1 cut(s)	20
Bsp19I	CCATGG	2 cut(s)	97, 609
BspACI	CCGC	1 cut(s)	281
BspANI	GGCC	1 cut(s)	297
BspCNI	CTCAG	2 cut(s)	159, 177
BspDI	ATCGAT	1 cut(s)	145
BspLI	GGNNCC	4 cut(s)	6, 22, 49, 103
BspMAI	CTGCAG	1 cut(s)	61
BspMI	ACCTGC	1 cut(s)	125
BspPI	GGATC	2 cut(s)	15, 28
BspT107I	GGYRCC	1 cut(s)	101
BspTNI	GGTCTC	1 cut(s)	181
BsrI	ACTGG	1 cut(s)	329
BssECI	CCNNGG	3 cut(s)	97, 292, 609
BssMI	GATC	1 cut(s)	20
BssT1I	CCWWGG	2 cut(s)	97, 609
Bst2UI	CCWGG	2 cut(s)	52, 294
Bst4CI	ACNGT	1 cut(s)	121
Bst6I	CTCTTC	1 cut(s)	219
BstDEI	CTNAG	2 cut(s)	167, 185
BstDSI	CCRYGG	2 cut(s)	97, 609
BstF5I	GGATG	1 cut(s)	517
BstHHI	GCGC	1 cut(s)	391
BstKTI	GATC	1 cut(s)	23
BstMAI	GTCTC	3 cut(s)	181, 280, 443
BstMBI	GATC	1 cut(s)	20
BstMWI	GCNNNNNNNGC	4 cut(s)	56, 131, 377, 386
BstNI	CCWGG	2 cut(s)	52, 294
BstSCI	CCNGG	2 cut(s)	50, 292
BstSFI	CTRYAG	1 cut(s)	57
BstV1I	GCAGC	3 cut(s)	398, 601, 604
BstV2I	GAAGAC	3 cut(s)	122, 236, 609
BstX2I	RGATCY	1 cut(s)	20
BstYI	RGATCY	1 cut(s)	20
Bsu15I	ATCGAT	1 cut(s)	145
BsuRI	GGCC	1 cut(s)	297
BsuTUI	ATCGAT	1 cut(s)	145
BtgI	CCRYGG	2 cut(s)	97, 609
BtsCI	GGATG	1 cut(s)	517
BtsIMutI	CAGTG	1 cut(s)	549
BveI	ACCTGC	1 cut(s)	125
CfoI	GCGC	1 cut(s)	391
ClaI	ATCGAT	1 cut(s)	145
Csp6I	GTAC	3 cut(s)	85, 402, 411
CviAII	CATG	2 cut(s)	98, 610
CviQI	GTAC	3 cut(s)	85, 402, 411
DdeI	CTNAG	2 cut(s)	167, 185
DpnI	GATC	1 cut(s)	22
DpnII	GATC	1 cut(s)	20
Eam1104I	CTCTTC	1 cut(s)	219
EarI	CTCTTC	1 cut(s)	219
Eco130I	CCWWGG	2 cut(s)	97, 609
Eco31I	GGTCTC	1 cut(s)	181
Eco57I	CTGAAG	1 cut(s)	573
EcoRI	GAATTC	1 cut(s)	328
EcoRII	CCWGG	2 cut(s)	50, 292
EcoT14I	CCWWGG	2 cut(s)	97, 609
ErhI	CCWWGG	2 cut(s)	97, 609
FaeI	CATG	2 cut(s)	101, 613
FaiI	YATR	7 cut(s)	38, 99, 131, 212, 249, 564, 611
FatI	CATG	2 cut(s)	97, 609
FauI	CCCGC	1 cut(s)	274
Fnu4HI	GCNGC	3 cut(s)	387, 615, 618
FokI	GGATG	1 cut(s)	524
Fsp4HI	GCNGC	3 cut(s)	387, 615, 618
FspBI	CTAG	1 cut(s)	408
GlaI	GCGC	1 cut(s)	390
GluI	GCNGC	3 cut(s)	387, 615, 618
HaeIII	GGCC	1 cut(s)	297
HhaI	GCGC	1 cut(s)	391
Hin1II	CATG	2 cut(s)	101, 613
Hin6I	GCGC	1 cut(s)	389
HinP1I	GCGC	1 cut(s)	389
HinfI	GANTC	2 cut(s)	142, 288
HphI	GGTGA	2 cut(s)	230, 589
Hpy166II	GTNNAC	2 cut(s)	529, 580
Hpy188I	TCNGA	1 cut(s)	511
Hpy188III	TCNNGA	2 cut(s)	199, 590
Hpy8I	GTNNAC	2 cut(s)	529, 580
Hpy99I	CGWCG	1 cut(s)	20
HpyAV	CCTTC	2 cut(s)	430, 548
HpyCH4III	ACNGT	1 cut(s)	121
HpyCH4V	TGCA	3 cut(s)	59, 80, 162
HpyF10VI	GCNNNNNNNGC	4 cut(s)	56, 131, 377, 386
HpyF3I	CTNAG	2 cut(s)	167, 185
Hsp92II	CATG	2 cut(s)	101, 613
HspAI	GCGC	1 cut(s)	389
Kzo9I	GATC	1 cut(s)	20
LmnI	GCTCC	2 cut(s)	10, 47
Lsp1109I	GCAGC	3 cut(s)	398, 601, 604
MaeI	CTAG	1 cut(s)	408
MalI	GATC	1 cut(s)	22
MboI	GATC	1 cut(s)	20
MflI	RGATCY	1 cut(s)	20
MluCI	AATT	1 cut(s)	328
MlyI	GAGTC	1 cut(s)	282
MmeI	TCCRAC	1 cut(s)	549
MnlI	CCTC	4 cut(s)	102, 197, 220, 438
MroXI	GAANNNNTTC	2 cut(s)	505, 533
MseI	TTAA	1 cut(s)	443
MspR9I	CCNGG	2 cut(s)	52, 294
MvaI	CCWGG	2 cut(s)	52, 294
MwoI	GCNNNNNNNGC	4 cut(s)	56, 131, 377, 386
NcoI	CCATGG	2 cut(s)	97, 609
NdeII	GATC	1 cut(s)	20
NlaIII	CATG	2 cut(s)	101, 613
NlaIV	GGNNCC	4 cut(s)	6, 22, 49, 103
PcsI	WCGNNNNNNNCGW	1 cut(s)	528
PdmI	GAANNNNTTC	2 cut(s)	505, 533
PfeI	GAWTC	1 cut(s)	142
PflMI	CCANNNNNTGG	1 cut(s)	111
PkrI	GCNGC	3 cut(s)	388, 616, 619
PleI	GAGTC	1 cut(s)	282
PpsI	GAGTC	1 cut(s)	282
Psp6I	CCWGG	2 cut(s)	50, 292
PspGI	CCWGG	2 cut(s)	50, 292
PspN4I	GGNNCC	4 cut(s)	6, 22, 49, 103
PstI	CTGCAG	1 cut(s)	61
PsuI	RGATCY	1 cut(s)	20
RsaI	GTAC	3 cut(s)	86, 403, 412
RsaNI	GTAC	3 cut(s)	85, 402, 411
SaqAI	TTAA	1 cut(s)	443
SatI	GCNGC	3 cut(s)	387, 615, 618
Sau3AI	GATC	1 cut(s)	20
ScaI	AGTACT	1 cut(s)	412
SchI	GAGTC	1 cut(s)	282
ScrFI	CCNGG	2 cut(s)	52, 294
SetI	ASST	8 cut(s)	36, 113, 139, 186, 255, 269, 373, 597
SfcI	CTRYAG	1 cut(s)	57
SmlI	CTYRAG	1 cut(s)	590
SmoI	CTYRAG	1 cut(s)	590
SpeI	ACTAGT	1 cut(s)	407
Sse9I	AATT	1 cut(s)	328
SsiI	CCGC	1 cut(s)	281
SspMI	CTAG	1 cut(s)	408
StyD4I	CCNGG	2 cut(s)	50, 292
StyI	CCWWGG	2 cut(s)	97, 609
TaaI	ACNGT	1 cut(s)	121
TaqI	TCGA	2 cut(s)	145, 522
TaqII	GACCGA	1 cut(s)	205
TasI	AATT	1 cut(s)	328
TatI	WGTACW	2 cut(s)	84, 410
TfiI	GAWTC	1 cut(s)	142
Tru1I	TTAA	1 cut(s)	443
Tru9I	TTAA	1 cut(s)	443
TscAI	CASTG	1 cut(s)	556
TseI	GCWGC	3 cut(s)	386, 614, 617
TspDTI	ATGAA	5 cut(s)	53, 236, 237, 324, 615
TspGWI	ACGGA	1 cut(s)	33
TspRI	CASTG	1 cut(s)	556
Van91I	CCANNNNNTGG	1 cut(s)	111
XapI	RAATTY	1 cut(s)	328
XmnI	GAANNNNTTC	2 cut(s)	505, 533
XspI	CTAG	1 cut(s)	408
ZrmI	AGTACT	1 cut(s)	412

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.