Rmu_sc0018708.1_g000002
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018708.1
Physical Location & Seq
Forward (+)
16059 .. 16552
494 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018708.1_g000002.1.cds

Sequence Viewer

Length: 213 bp
atgatcttatcatcttgtttacaagacagaattctagtagatgctgttgagaagtacaatggcaaaaactggaaaaggatcgttgaatgtgttcgtggcagaacagatgttcagtgccttcacctccggcagaaactcatctcacttgatcttgttaaaggattttggtataaagaggaagatgatctaataattaagttagttgcaaagtag

Protein Analysis

70

Amino Acids

8.25

Weight (kDa)

8.88

Isoelectric Point (pI)

41.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 86
AcsI RAATTY 1 cut(s) 30
AfaI GTAC 1 cut(s) 56
AgsI TTSAA 1 cut(s) 86
AlwI GGATC 1 cut(s) 86
ApoI RAATTY 1 cut(s) 30
Asp700I GAANNNNTTC 1 cut(s) 90
AsuHPI GGTGA 1 cut(s) 113
BfaI CTAG 1 cut(s) 35
BmsI GCATC 1 cut(s) 31
Bse1I ACTGG 1 cut(s) 74
BseNI ACTGG 1 cut(s) 74
BsiSI CCGG 1 cut(s) 127
Bsp143I GATC 4 cut(s) 3, 78, 148, 184
BspPI GGATC 1 cut(s) 86
BsrI ACTGG 1 cut(s) 74
BssMI GATC 4 cut(s) 3, 78, 148, 184
BstKTI GATC 4 cut(s) 6, 81, 151, 187
BstMBI GATC 4 cut(s) 3, 78, 148, 184
BtsIMutI CAGTG 1 cut(s) 119
Csp6I GTAC 1 cut(s) 55
CviQI GTAC 1 cut(s) 55
DpnI GATC 4 cut(s) 5, 80, 150, 186
DpnII GATC 4 cut(s) 3, 78, 148, 184
EcoRI GAATTC 1 cut(s) 30
FaiI YATR 1 cut(s) 171
FspBI CTAG 1 cut(s) 35
HapII CCGG 1 cut(s) 127
HpaII CCGG 1 cut(s) 127
HphI GGTGA 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 20
Hpy8I GTNNAC 1 cut(s) 20
HpyAV CCTTC 1 cut(s) 128
HpyCH4V TGCA 1 cut(s) 206
Kzo9I GATC 4 cut(s) 3, 78, 148, 184
LpnPI CCDG 2 cut(s) 55, 140
LweI GCATC 1 cut(s) 31
MaeI CTAG 1 cut(s) 35
MalI GATC 4 cut(s) 5, 80, 150, 186
MboI GATC 4 cut(s) 3, 78, 148, 184
MboII GAAGA 1 cut(s) 191
MluCI AATT 2 cut(s) 30, 192
MnlI CCTC 2 cut(s) 134, 169
MroXI GAANNNNTTC 1 cut(s) 90
MseI TTAA 2 cut(s) 156, 195
MspI CCGG 1 cut(s) 127
NdeII GATC 4 cut(s) 3, 78, 148, 184
PdmI GAANNNNTTC 1 cut(s) 90
RsaI GTAC 1 cut(s) 56
RsaNI GTAC 1 cut(s) 55
SaqAI TTAA 2 cut(s) 156, 195
Sau3AI GATC 4 cut(s) 3, 78, 148, 184
SetI ASST 1 cut(s) 126
SfaNI GCATC 1 cut(s) 31
SgeI CNNG 8 cut(s) 27, 35, 47, 82, 107, 139, 158, 164
Sse9I AATT 2 cut(s) 30, 192
SspMI CTAG 1 cut(s) 35
TasI AATT 2 cut(s) 30, 192
TatI WGTACW 1 cut(s) 54
Tru1I TTAA 2 cut(s) 156, 195
Tru9I TTAA 2 cut(s) 156, 195
TscAI CASTG 1 cut(s) 119
TspRI CASTG 1 cut(s) 119
XapI RAATTY 1 cut(s) 30
XmnI GAANNNNTTC 1 cut(s) 90
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.