Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0020945.1

Orthogroup ID

OG0006941

Physical Location & Seq

Genomic Coordinates Reverse (-)

4636 .. 8766

Gene Structure 4131 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0020945.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1221 bp

atggataatgtgagcttctttggtgacgaagagcttttaaaggatgtcttttctttacaagttagccaggaaacaaattcattggttgtaaagatcagccaaaaggataatgcggttgattctttcaagagagcctgcattattttcagttcagagcccgagccattgcatatttgggacttctcagggcagacaacccaatttttcatgaatgacagaattagtttgccaaatgacattcctggacaactgaacaaagagattgtcctggaattgcatcttcatggattttcagaggtcagaggttggagaagtgatgacatggctgaaaaccacttcagtattgatggttgtattagtggtggctcttctaaaatgaatgggaacatttactacgtcaatccctacttaaactcaagcaactcctggcgaagtgctgttatgtatagaggagttggttctttaggcttaactggtataaagaatcttgggaatacttgttttatgaacagtgcaatccaatgtttggtgcacactccaaagcttgttgactattttctaggagattactggaaggacatgaactatcagaacccattgggaatgaaaggagagcttgcttttgcatttggagaattattgaggagattatgggctccaggtgcaaggccagtggcttcaagaatgttcaagcaaaaacttgccagttttgctcctcaattcagtggctataatcaactgattcccaggttagtgagtaattttgagggtcatccagatgaagaagtggcggaagaatattggcggaatcaccttgctcgcaatgattccattattgttaatgcataccagggtcaataccggtcaaaattggtttgccccgattgcaacaaggtgtccattacatttgacccatttatgtatctatcactgccattaccttctactacaatgcggagtatgactttgacggttttaagcacagatggtgctgcgttgcctactacatttactgtaacagtgccaaagagtgggaagctcgtggatcttactgaagccttaagtattgcctgttctctaagagatgatgaaaccctgttggtggctgagatataccagtgtcgcatatttcgtttattggaggatccatctgattcattagcctttgttagagacgctgacaaactggttgcttatcgcttaccaaaagattttgagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04137 map04137

Pfam Domains

Protein Families

UCH

Protein Analysis

406

Amino Acids

45.76

Weight (kDa)

5.3

Isoelectric Point (pI)

33.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006941)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g20680 FvH4_6g20680 FvH4_6g20680
malus_domestica	MD00G1072700.v1.1 MD12G1043100.v1.1 MD14G1042200.v1.1
prunus_persica	Prupe.7G091700_v2.0.a1 Prupe.7G091700_v2.0.a1 Prupe.7G091700_v2.0.a1 Prupe.7G091700_v2.0.a1
pyrus_communis	pycom12g03720 pycom14g03580
rosa_chinensis	RchiOBHm_Chr3g0476581
rosa_laevigata	RLG00000001984 RLG00000023761
rosa_multiflora	Rmu_sc0008241.1_g000007 Rmu_sc0020945.1_g000001
rosa_roxburghii	Rroxscaffold_6G00405190
rosa_rugosa	Rorug03G0155400
rosa_samantha	Rh3AG206000 Rh3BG238600 Rh3CG232300 Rh3DG232200 Rh7DG310400
rosa_wichuraiana	Rw3G018760 Rw7G026340

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	526, 1031
AciI	CCGC	4 cut(s)	113, 791, 805, 955
AclWI	GGATC	3 cut(s)	1053, 1139, 1152
AcsI	RAATTY	1 cut(s)	76
AcuI	CTGAAG	2 cut(s)	322, 1074
AfiI	CCNNNNNNNGG	3 cut(s)	526, 1031, 1102
AflII	CTTAAG	1 cut(s)	1060
AgeI	ACCGGT	1 cut(s)	861
AgsI	TTSAA	3 cut(s)	127, 681, 691
AjnI	CCWGG	7 cut(s)	66, 241, 267, 425, 658, 746, 849
AluBI	AGCT	5 cut(s)	15, 34, 544, 616, 1039
AluI	AGCT	5 cut(s)	15, 34, 544, 616, 1039
Alw21I	GWGCWC	1 cut(s)	534
Alw26I	GTCTC	1 cut(s)	1167
Alw44I	GTGCAC	1 cut(s)	530
AlwI	GGATC	3 cut(s)	1053, 1139, 1152
Ama87I	CYCGRG	1 cut(s)	158
AoxI	GGCC	1 cut(s)	668
ApaLI	GTGCAC	1 cut(s)	530
ApeKI	GCWGC	1 cut(s)	992
ApoI	RAATTY	1 cut(s)	76
ArsI	GACNNNNNNTTYG	2 cut(s)	249, 281
AsiGI	ACCGGT	1 cut(s)	861
AsuHPI	GGTGA	2 cut(s)	35, 803
AvaI	CYCGRG	1 cut(s)	158
BaeGI	GKGCMC	1 cut(s)	534
BamHI	GGATCC	1 cut(s)	1144
BanII	GRGCYC	2 cut(s)	159, 658
BauI	CACGAG	1 cut(s)	1040
Bbv12I	GWGCWC	1 cut(s)	534
BbvI	GCAGC	1 cut(s)	979
BccI	CCATC	3 cut(s)	341, 980, 1156
BciT130I	CCWGG	7 cut(s)	68, 243, 269, 427, 660, 748, 851
BcoDI	GTCTC	1 cut(s)	1167
BfaI	CTAG	1 cut(s)	560
BfrI	CTTAAG	1 cut(s)	1060
BisI	GCNGC	1 cut(s)	993
BlsI	GCNGC	1 cut(s)	994
Bme1390I	CCNGG	7 cut(s)	68, 243, 269, 427, 660, 748, 851
BmeT110I	CYCGRG	1 cut(s)	158
BmiI	GGNNCC	2 cut(s)	657, 1146
BmrFI	CCNGG	7 cut(s)	68, 243, 269, 427, 660, 748, 851
BmsI	GCATC	1 cut(s)	286
BpmI	CTGGAG	1 cut(s)	642
BpuEI	CTTGAG	1 cut(s)	400
BsaJI	CCNNGG	2 cut(s)	746, 850
BsaWI	WCCGGW	1 cut(s)	861
Bsc4I	CCNNNNNNNGG	3 cut(s)	526, 1031, 1102
Bse118I	RCCGGY	1 cut(s)	861
Bse1I	ACTGG	6 cut(s)	478, 575, 671, 705, 1117, 1191
Bse3DI	GCAATG	2 cut(s)	164, 829
BseBI	CCWGG	7 cut(s)	68, 243, 269, 427, 660, 748, 851
BseDI	CCNNGG	2 cut(s)	746, 850
BseGI	GGATG	2 cut(s)	49, 772
BseLI	CCNNNNNNNGG	3 cut(s)	526, 1031, 1102
BseMI	GCAATG	2 cut(s)	164, 829
BseMII	CTCAG	2 cut(s)	198, 1098
BseNI	ACTGG	6 cut(s)	478, 575, 671, 705, 1117, 1191
BseRI	GAGGAG	3 cut(s)	465, 658, 705
BseSI	GKGCMC	1 cut(s)	534
BseXI	GCAGC	1 cut(s)	979
BshFI	GGCC	1 cut(s)	670
BshTI	ACCGGT	1 cut(s)	861
BsiHKAI	GWGCWC	1 cut(s)	534
BsiHKCI	CYCGRG	1 cut(s)	158
BsiSI	CCGG	1 cut(s)	862
BslFI	GGGAC	1 cut(s)	191
BslI	CCNNNNNNNGG	3 cut(s)	526, 1031, 1102
BsmAI	GTCTC	1 cut(s)	1167
BsmBI	CGTCTC	1 cut(s)	1167
BsmFI	GGGAC	1 cut(s)	191
BsnI	GGCC	1 cut(s)	670
BsoBI	CYCGRG	1 cut(s)	158
Bsp1286I	GDGCHC	3 cut(s)	159, 534, 658
Bsp143I	GATC	3 cut(s)	93, 1045, 1144
BspACI	CCGC	4 cut(s)	113, 791, 805, 955
BspANI	GGCC	1 cut(s)	670
BspCNI	CTCAG	2 cut(s)	197, 1099
BspHI	TCATGA	1 cut(s)	207
BspLI	GGNNCC	2 cut(s)	657, 1146
BspPI	GGATC	3 cut(s)	1053, 1139, 1152
BspQI	GCTCTTC	2 cut(s)	24, 373
BspTI	CTTAAG	1 cut(s)	1060
BsrDI	GCAATG	2 cut(s)	164, 829
BsrFI	RCCGGY	1 cut(s)	861
BsrI	ACTGG	6 cut(s)	478, 575, 671, 705, 1117, 1191
BssAI	RCCGGY	1 cut(s)	861
BssECI	CCNNGG	2 cut(s)	746, 850
BssMI	GATC	3 cut(s)	93, 1045, 1144
BssSI	CACGAG	1 cut(s)	1040
Bst2BI	CACGAG	1 cut(s)	1040
Bst2UI	CCWGG	7 cut(s)	68, 243, 269, 427, 660, 748, 851
Bst4CI	ACNGT	4 cut(s)	512, 973, 1015, 1021
Bst6I	CTCTTC	2 cut(s)	24, 373
BstAFI	CTTAAG	1 cut(s)	1060
BstC8I	GCNNGC	3 cut(s)	136, 618, 820
BstDEI	CTNAG	3 cut(s)	184, 1079, 1107
BstF5I	GGATG	2 cut(s)	49, 772
BstKTI	GATC	3 cut(s)	96, 1048, 1147
BstMAI	GTCTC	1 cut(s)	1167
BstMBI	GATC	3 cut(s)	93, 1045, 1144
BstMWI	GCNNNNNNNGC	3 cut(s)	662, 710, 885
BstNI	CCWGG	7 cut(s)	68, 243, 269, 427, 660, 748, 851
BstSCI	CCNGG	7 cut(s)	66, 241, 267, 425, 658, 746, 849
BstSLI	GKGCMC	1 cut(s)	534
BstV1I	GCAGC	1 cut(s)	979
BstX2I	RGATCY	2 cut(s)	1045, 1144
BstYI	RGATCY	2 cut(s)	1045, 1144
BsuRI	GGCC	1 cut(s)	670
BtsCI	GGATG	2 cut(s)	49, 772
BtsI	GCAGTG	1 cut(s)	929
BtsIMutI	CAGTG	6 cut(s)	517, 678, 730, 929, 1026, 1124
Cac8I	GCNNGC	3 cut(s)	136, 618, 820
CciI	TCATGA	1 cut(s)	207
Cfr10I	RCCGGY	1 cut(s)	861
CseI	GACGC	1 cut(s)	1184
CspAI	ACCGGT	1 cut(s)	861
CspCI	CAANNNNNGTGG	2 cut(s)	654, 689
CviAII	CATG	4 cut(s)	208, 284, 322, 580
DdeI	CTNAG	3 cut(s)	184, 1079, 1107
DpnI	GATC	3 cut(s)	95, 1047, 1146
DpnII	GATC	3 cut(s)	93, 1045, 1144
DraI	TTTAAA	1 cut(s)	39
Eam1104I	CTCTTC	2 cut(s)	24, 373
EarI	CTCTTC	2 cut(s)	24, 373
EciI	GGCGGA	2 cut(s)	806, 820
Eco24I	GRGCYC	2 cut(s)	159, 658
Eco57I	CTGAAG	2 cut(s)	322, 1074
Eco88I	CYCGRG	1 cut(s)	158
EcoRII	CCWGG	7 cut(s)	66, 241, 267, 425, 658, 746, 849
EcoT22I	ATGCAT	1 cut(s)	847
EcoT38I	GRGCYC	2 cut(s)	159, 658
Esp3I	CGTCTC	1 cut(s)	1167
FaeI	CATG	4 cut(s)	211, 287, 325, 583
FalI	AAGNNNNNCTT	4 cut(s)	32, 64, 600, 632
FaqI	GGGAC	1 cut(s)	191
FatI	CATG	4 cut(s)	207, 283, 321, 579
Fnu4HI	GCNGC	1 cut(s)	993
FokI	GGATG	2 cut(s)	56, 759
FriOI	GRGCYC	2 cut(s)	159, 658
Fsp4HI	GCNGC	1 cut(s)	993
FspBI	CTAG	1 cut(s)	560
GluI	GCNGC	1 cut(s)	993
GsuI	CTGGAG	1 cut(s)	642
HaeIII	GGCC	1 cut(s)	670
HapII	CCGG	1 cut(s)	862
HgaI	GACGC	1 cut(s)	1184
Hin1II	CATG	4 cut(s)	211, 287, 325, 583
HincII	GTYRAC	1 cut(s)	550
HindII	GTYRAC	1 cut(s)	550
HindIII	AAGCTT	1 cut(s)	542
HinfI	GANTC	6 cut(s)	119, 484, 742, 808, 827, 1154
HpaII	CCGG	1 cut(s)	862
HphI	GGTGA	2 cut(s)	35, 803
Hpy166II	GTNNAC	2 cut(s)	532, 550
Hpy188I	TCNGA	5 cut(s)	154, 295, 302, 591, 1153
Hpy188III	TCNNGA	4 cut(s)	127, 208, 681, 776
Hpy8I	GTNNAC	2 cut(s)	532, 550
HpyAV	CCTTC	2 cut(s)	568, 951
HpyCH4III	ACNGT	4 cut(s)	512, 973, 1015, 1021
HpyCH4IV	ACGT	1 cut(s)	396
HpyCH4V	TGCA	9 cut(s)	138, 169, 277, 515, 532, 626, 665, 845, 888
HpyF10VI	GCNNNNNNNGC	3 cut(s)	662, 710, 885
HpyF3I	CTNAG	3 cut(s)	184, 1079, 1107
HpySE526I	ACGT	1 cut(s)	396
Hsp92II	CATG	4 cut(s)	211, 287, 325, 583
Kzo9I	GATC	3 cut(s)	93, 1045, 1144
LguI	GCTCTTC	2 cut(s)	24, 373
LmnI	GCTCC	2 cut(s)	661, 718
Lsp1109I	GCAGC	1 cut(s)	979
LweI	GCATC	1 cut(s)	286
MaeI	CTAG	1 cut(s)	560
MaeII	ACGT	1 cut(s)	396
MaeIII	GTNAC	2 cut(s)	23, 1015
MalI	GATC	3 cut(s)	95, 1047, 1146
MboI	GATC	3 cut(s)	93, 1045, 1144
MboII	GAAGA	5 cut(s)	41, 272, 360, 794, 806
MflI	RGATCY	2 cut(s)	1045, 1144
MhlI	GDGCHC	3 cut(s)	159, 534, 658
MluCI	AATT	8 cut(s)	76, 200, 219, 272, 635, 719, 760, 869
MmeI	TCCRAC	1 cut(s)	287
MnlI	CCTC	7 cut(s)	289, 296, 443, 636, 726, 760, 1135
Mph1103I	ATGCAT	1 cut(s)	847
MseI	TTAA	6 cut(s)	38, 410, 470, 840, 977, 1061
MslI	CAYNNNNRTG	2 cut(s)	282, 777
MspCI	CTTAAG	1 cut(s)	1060
MspI	CCGG	1 cut(s)	862
MspR9I	CCNGG	7 cut(s)	68, 243, 269, 427, 660, 748, 851
MvaI	CCWGG	7 cut(s)	68, 243, 269, 427, 660, 748, 851
MwoI	GCNNNNNNNGC	3 cut(s)	662, 710, 885
NdeII	GATC	3 cut(s)	93, 1045, 1144
NlaIII	CATG	4 cut(s)	211, 287, 325, 583
NlaIV	GGNNCC	2 cut(s)	657, 1146
NmuCI	GTSAC	1 cut(s)	23
NsiI	ATGCAT	1 cut(s)	847
PagI	TCATGA	1 cut(s)	207
PciSI	GCTCTTC	2 cut(s)	24, 373
PcsI	WCGNNNNNNNCGW	1 cut(s)	1129
PfeI	GAWTC	6 cut(s)	119, 484, 742, 808, 827, 1154
PflMI	CCANNNNNTGG	2 cut(s)	526, 1031
PfoI	TCCNGGA	2 cut(s)	241, 267
PinAI	ACCGGT	1 cut(s)	861
PkrI	GCNGC	1 cut(s)	994
Psp6I	CCWGG	7 cut(s)	66, 241, 267, 425, 658, 746, 849
PspGI	CCWGG	7 cut(s)	66, 241, 267, 425, 658, 746, 849
PspN4I	GGNNCC	2 cut(s)	657, 1146
PsrI	GAACNNNNNNTAC	4 cut(s)	377, 409, 1057, 1089
PsuI	RGATCY	2 cut(s)	1045, 1144
RseI	CAYNNNNRTG	2 cut(s)	282, 777
SapI	GCTCTTC	2 cut(s)	24, 373
SaqAI	TTAA	6 cut(s)	38, 410, 470, 840, 977, 1061
SatI	GCNGC	1 cut(s)	993
Sau3AI	GATC	3 cut(s)	93, 1045, 1144
ScrFI	CCNGG	7 cut(s)	68, 243, 269, 427, 660, 748, 851
SduI	GDGCHC	3 cut(s)	159, 534, 658
SfaNI	GCATC	1 cut(s)	286
SmiMI	CAYNNNNRTG	2 cut(s)	282, 777
SmlI	CTYRAG	2 cut(s)	415, 1060
SmoI	CTYRAG	2 cut(s)	415, 1060
Sse9I	AATT	8 cut(s)	76, 200, 219, 272, 635, 719, 760, 869
SsiI	CCGC	4 cut(s)	113, 791, 805, 955
SspI	AATATT	1 cut(s)	800
SspMI	CTAG	1 cut(s)	560
StyD4I	CCNGG	7 cut(s)	66, 241, 267, 425, 658, 746, 849
TaaI	ACNGT	4 cut(s)	512, 973, 1015, 1021
TaiI	ACGT	1 cut(s)	399
TasI	AATT	8 cut(s)	76, 200, 219, 272, 635, 719, 760, 869
TfiI	GAWTC	6 cut(s)	119, 484, 742, 808, 827, 1154
Tru1I	TTAA	6 cut(s)	38, 410, 470, 840, 977, 1061
Tru9I	TTAA	6 cut(s)	38, 410, 470, 840, 977, 1061
TscAI	CASTG	6 cut(s)	517, 678, 730, 936, 1026, 1124
TseFI	GTSAC	1 cut(s)	23
TseI	GCWGC	1 cut(s)	992
Tsp45I	GTSAC	1 cut(s)	23
TspRI	CASTG	6 cut(s)	517, 678, 730, 936, 1026, 1124
Van91I	CCANNNNNTGG	2 cut(s)	526, 1031
Vha464I	CTTAAG	1 cut(s)	1060
VneI	GTGCAC	1 cut(s)	530
XapI	RAATTY	1 cut(s)	76
XcmI	CCANNNNNNNNNTGG	1 cut(s)	171
XspI	CTAG	1 cut(s)	560
Zsp2I	ATGCAT	1 cut(s)	847

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.