Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0021303.1

Orthogroup ID

OG0005281

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1316

Gene Structure 1316 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0021303.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1084 bp

tgcaagtgtgtttggggtctcagcggagtcaatgcagttgtcttttgattcaaaagggaatagcgtccctactattctcttgctgatgcaggagagattatactcacaaggaggattgaaggcagaaggaatattccgtataaacccggagaacagcaaagaggagtttgtgagaaaccagttgaacagaggcattgtgcctgatgacattgacgtccattgcttggcgggcctaatcaaagcctggtttcgagaacttccttcaggagtgctagatggactatctcctgaagaagttcttcagtgcaacacagaagaggaatcctttgagcttgtgaagcagttaaagccaaccgaggctgcattactcaattgggctatcggtctgatggctgatgttgttgaggaagaagaattcaacaaaatgaatgcaagaaatattgctatggtttttgctccaaacatgactcagatgtctgatccactaacggctttgatgcatgcggttcaagtaatgaatttgcttaagaccctgattatgaaaacactaagggaacgtgaagagactgatgaaactggaggatattcacccatgtcatcttgtttatctgatcatcaatcagacgaagacttgtatagtcatccagacatggataccaacggagacttgtatagtcatccagacatggataccaactctgaattgagaggactaacatcagattatgatgaaaatgcccactatagcaacagcagtgaagatgaagatgaagttcggccactcagtgacatagaagaatgcttcttaagacgattggatgagaagaaaacagccccaaatagcatggtaatgctgaataaaccaacaagtaagtcacttggtgagtatccgagtcctcaaagttgctcgagctttaacatggaatctggcacatcttctgttgatagcaaaaatgggaattctggcttgtgtgcaagttatgggaaagactctggaaaatgcactgatatggagagcccttcagtatcatgctcaaccttgaaggaaatggatatggaggacaatggagtctgtttcaactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PBD RhoGAP

Protein Analysis

360

Amino Acids

39.88

Weight (kDa)

4.38

Isoelectric Point (pI)

54.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005281)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G03100
fragaria_vesca	FvH4_2g24600 FvH4_2g24611
malus_domestica	MD03G1274800.v1.1 MD03G1274900.v1.1 MD11G1296900.v1.1
prunus_persica	Prupe.8G251200_v2.0.a1 Prupe.8G251400_v2.0.a1
pyrus_communis	pycom03g21890 pycom11g26120
rosa_chinensis	RchiOBHm_Chr6g0292421 RchiOBHm_Chr6g0292441
rosa_laevigata	RLG00000012024 RLG00000012026
rosa_multiflora	Rmu_sc0001354.1_g000021 Rmu_sc0012226.1_g000005 Rmu_sc0021303.1_g000001
rosa_roxburghii	Rroxscaffold_7G00175060 Rroxscaffold_7G00175080
rosa_rugosa	Rorug06G0226500 Rorug06G0226700
rosa_samantha	Rh6AG339800 Rh6BG347000 Rh6BG347200 Rh6CG353900 Rh6CG354100 Rh6DG339800
rosa_wichuraiana	Rw6G029570 Rw6G029590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	3 cut(s)	213, 473, 1068
AatII	GACGTC	1 cut(s)	217
AccB7I	CCANNNNNTGG	1 cut(s)	224
AciI	CCGC	3 cut(s)	24, 228, 504
AclWI	GGATC	1 cut(s)	474
AcoI	YGGCCR	1 cut(s)	777
AcsI	RAATTY	3 cut(s)	414, 518, 959
AcuI	CTGAAG	4 cut(s)	247, 285, 310, 1006
AcyI	GRCGYC	1 cut(s)	214
AdeI	CACNNNGTG	2 cut(s)	786, 882
AfiI	CCNNNNNNNGG	1 cut(s)	224
AflII	CTTAAG	2 cut(s)	525, 806
AgsI	TTSAA	7 cut(s)	52, 119, 185, 419, 510, 1043, 1079
AjnI	CCWGG	1 cut(s)	243
AluBI	AGCT	2 cut(s)	332, 913
AluI	AGCT	2 cut(s)	332, 913
Alw26I	GTCTC	3 cut(s)	23, 558, 658
AlwI	GGATC	1 cut(s)	474
Ama87I	CYCGRG	1 cut(s)	908
AoxI	GGCC	2 cut(s)	230, 777
ApeKI	GCWGC	1 cut(s)	360
ApoI	RAATTY	3 cut(s)	414, 518, 959
Asp700I	GAANNNNTTC	2 cut(s)	295, 298
AspS9I	GGNCC	1 cut(s)	230
AsuC2I	CCSGG	1 cut(s)	147
AsuHPI	GGTGA	2 cut(s)	580, 894
AvaI	CYCGRG	1 cut(s)	908
BanII	GRGCYC	1 cut(s)	1020
BbsI	GAAGAC	1 cut(s)	634
BbvI	GCAGC	1 cut(s)	347
BccI	CCATC	2 cut(s)	270, 383
BceAI	ACGGC	1 cut(s)	505
BciT130I	CCWGG	1 cut(s)	245
BciVI	GTATCC	3 cut(s)	647, 683, 898
BclI	TGATCA	1 cut(s)	611
BcnI	CCSGG	1 cut(s)	147
BcoDI	GTCTC	3 cut(s)	23, 558, 658
BfaI	CTAG	2 cut(s)	273, 1082
BfmI	CTRYAG	1 cut(s)	743
BfrI	CTTAAG	2 cut(s)	525, 806
BfuI	GTATCC	3 cut(s)	647, 683, 898
BisI	GCNGC	1 cut(s)	361
BlsI	GCNGC	1 cut(s)	362
Bme1390I	CCNGG	2 cut(s)	147, 245
BmeT110I	CYCGRG	1 cut(s)	908
BmgT120I	GGNCC	1 cut(s)	230
BmrFI	CCNGG	2 cut(s)	147, 245
BmsI	GCATC	2 cut(s)	76, 487
BpiI	GAAGAC	1 cut(s)	634
BpmI	CTGGAG	1 cut(s)	598
BpuMI	CCSGG	1 cut(s)	147
BsaHI	GRCGYC	1 cut(s)	214
BsaI	GGTCTC	1 cut(s)	23
BsaJI	CCNNGG	1 cut(s)	355
Bsc4I	CCNNNNNNNGG	1 cut(s)	224
Bse1I	ACTGG	2 cut(s)	179, 581
Bse3DI	GCAATG	1 cut(s)	218
BseBI	CCWGG	1 cut(s)	245
BseDI	CCNNGG	1 cut(s)	355
BseGI	GGATG	3 cut(s)	641, 677, 824
BseLI	CCNNNNNNNGG	1 cut(s)	224
BseMI	GCAATG	1 cut(s)	218
BseMII	CTCAG	3 cut(s)	34, 483, 797
BseNI	ACTGG	2 cut(s)	179, 581
BseRI	GAGGAG	1 cut(s)	177
BseXI	GCAGC	1 cut(s)	347
BshFI	GGCC	2 cut(s)	232, 779
BsiHKCI	CYCGRG	1 cut(s)	908
BsiSI	CCGG	1 cut(s)	147
BslFI	GGGAC	1 cut(s)	51
BslI	CCNNNNNNNGG	1 cut(s)	224
BsmAI	GTCTC	3 cut(s)	23, 558, 658
BsmFI	GGGAC	1 cut(s)	51
BsmI	GAATGC	2 cut(s)	434, 804
BsnI	GGCC	2 cut(s)	232, 779
Bso31I	GGTCTC	1 cut(s)	23
BsoBI	CYCGRG	1 cut(s)	908
Bsp1286I	GDGCHC	1 cut(s)	1020
Bsp143I	GATC	2 cut(s)	479, 611
BspACI	CCGC	3 cut(s)	24, 228, 504
BspANI	GGCC	2 cut(s)	232, 779
BspCNI	CTCAG	3 cut(s)	33, 482, 796
BspPI	GGATC	1 cut(s)	474
BspTI	CTTAAG	2 cut(s)	525, 806
BspTNI	GGTCTC	1 cut(s)	23
BsrDI	GCAATG	1 cut(s)	218
BsrI	ACTGG	2 cut(s)	179, 581
BssECI	CCNNGG	1 cut(s)	355
BssMI	GATC	2 cut(s)	479, 611
BssNI	GRCGYC	1 cut(s)	214
Bst2UI	CCWGG	1 cut(s)	245
Bst6I	CTCTTC	2 cut(s)	310, 556
BstACI	GRCGYC	1 cut(s)	214
BstAFI	CTTAAG	2 cut(s)	525, 806
BstC8I	GCNNGC	2 cut(s)	230, 502
BstDEI	CTNAG	4 cut(s)	20, 469, 549, 783
BstF5I	GGATG	3 cut(s)	641, 677, 824
BstKTI	GATC	2 cut(s)	482, 614
BstMAI	GTCTC	3 cut(s)	23, 558, 658
BstMBI	GATC	2 cut(s)	479, 611
BstMWI	GCNNNNNNNGC	3 cut(s)	229, 338, 347
BstNI	CCWGG	1 cut(s)	245
BstNSI	RCATGY	1 cut(s)	504
BstSCI	CCNGG	2 cut(s)	145, 243
BstSFI	CTRYAG	1 cut(s)	743
BstV1I	GCAGC	1 cut(s)	347
BstV2I	GAAGAC	1 cut(s)	634
BsuI	GTATCC	3 cut(s)	647, 683, 898
BsuRI	GGCC	2 cut(s)	232, 779
BtsCI	GGATG	3 cut(s)	641, 677, 824
BtsI	GCAGTG	1 cut(s)	761
BtsIMutI	CAGTG	4 cut(s)	309, 761, 791, 1003
Cac8I	GCNNGC	2 cut(s)	230, 502
Cfr13I	GGNCC	1 cut(s)	230
CseI	GACGC	1 cut(s)	53
CviAII	CATG	8 cut(s)	464, 501, 593, 650, 686, 845, 920, 1030
DdeI	CTNAG	4 cut(s)	20, 469, 549, 783
DpnI	GATC	2 cut(s)	481, 613
DpnII	GATC	2 cut(s)	479, 611
DraIII	CACNNNGTG	2 cut(s)	786, 882
DrdI	GACNNNNNNGTC	3 cut(s)	213, 473, 1068
DseDI	GACNNNNNNGTC	3 cut(s)	213, 473, 1068
EaeI	YGGCCR	1 cut(s)	777
Eam1104I	CTCTTC	2 cut(s)	310, 556
EarI	CTCTTC	2 cut(s)	310, 556
Eco24I	GRGCYC	1 cut(s)	1020
Eco31I	GGTCTC	1 cut(s)	23
Eco57I	CTGAAG	4 cut(s)	247, 285, 310, 1006
Eco88I	CYCGRG	1 cut(s)	908
EcoRI	GAATTC	2 cut(s)	414, 959
EcoRII	CCWGG	1 cut(s)	243
EcoT22I	ATGCAT	1 cut(s)	502
EcoT38I	GRGCYC	1 cut(s)	1020
FaeI	CATG	8 cut(s)	467, 504, 596, 653, 689, 848, 923, 1033
FalI	AAGNNNNNCTT	2 cut(s)	283, 315
FaqI	GGGAC	1 cut(s)	51
FatI	CATG	8 cut(s)	463, 500, 592, 649, 685, 844, 919, 1029
FauI	CCCGC	1 cut(s)	221
FbaI	TGATCA	1 cut(s)	611
Fnu4HI	GCNGC	1 cut(s)	361
FokI	GGATG	3 cut(s)	628, 664, 831
FriOI	GRGCYC	1 cut(s)	1020
Fsp4HI	GCNGC	1 cut(s)	361
FspBI	CTAG	2 cut(s)	273, 1082
GluI	GCNGC	1 cut(s)	361
GsuI	CTGGAG	1 cut(s)	598
HaeIII	GGCC	2 cut(s)	232, 779
HapII	CCGG	1 cut(s)	147
HgaI	GACGC	1 cut(s)	53
Hin1I	GRCGYC	1 cut(s)	214
Hin1II	CATG	8 cut(s)	467, 504, 596, 653, 689, 848, 923, 1033
HinfI	GANTC	8 cut(s)	27, 48, 321, 467, 893, 924, 990, 1069
HpaII	CCGG	1 cut(s)	147
HphI	GGTGA	2 cut(s)	580, 894
Hpy188I	TCNGA	8 cut(s)	388, 472, 479, 611, 623, 701, 722, 892
Hpy188III	TCNNGA	6 cut(s)	252, 265, 288, 645, 681, 994
HpyAV	CCTTC	5 cut(s)	113, 120, 271, 1030, 1037
HpyCH4IV	ACGT	2 cut(s)	214, 557
HpyCH4V	TGCA	9 cut(s)	3, 35, 89, 307, 363, 432, 500, 975, 1003
HpyF10VI	GCNNNNNNNGC	3 cut(s)	229, 338, 347
HpyF3I	CTNAG	4 cut(s)	20, 469, 549, 783
HpySE526I	ACGT	2 cut(s)	214, 557
Hsp92I	GRCGYC	1 cut(s)	214
Hsp92II	CATG	8 cut(s)	467, 504, 596, 653, 689, 848, 923, 1033
Ksp22I	TGATCA	1 cut(s)	611
Kzo9I	GATC	2 cut(s)	479, 611
LmnI	GCTCC	1 cut(s)	461
Lsp1109I	GCAGC	1 cut(s)	347
LweI	GCATC	2 cut(s)	76, 487
MaeI	CTAG	2 cut(s)	273, 1082
MaeII	ACGT	2 cut(s)	214, 557
MaeIII	GTNAC	2 cut(s)	786, 874
MalI	GATC	2 cut(s)	481, 613
MboI	GATC	2 cut(s)	479, 611
MfeI	CAATTG	1 cut(s)	371
MhlI	GDGCHC	1 cut(s)	1020
MluCI	AATT	5 cut(s)	371, 414, 518, 702, 959
MlyI	GAGTC	5 cut(s)	36, 461, 902, 984, 1078
Mph1103I	ATGCAT	1 cut(s)	502
MroXI	GAANNNNTTC	2 cut(s)	295, 298
MseI	TTAA	4 cut(s)	345, 526, 807, 916
MslI	CAYNNNNRTG	2 cut(s)	849, 1008
MspA1I	CMGCKG	1 cut(s)	24
MspCI	CTTAAG	2 cut(s)	525, 806
MspI	CCGG	1 cut(s)	147
MspR9I	CCNGG	2 cut(s)	147, 245
MunI	CAATTG	1 cut(s)	371
Mva1269I	GAATGC	2 cut(s)	434, 804
MvaI	CCWGG	1 cut(s)	245
MwoI	GCNNNNNNNGC	3 cut(s)	229, 338, 347
NciI	CCSGG	1 cut(s)	147
NdeII	GATC	2 cut(s)	479, 611
NlaIII	CATG	8 cut(s)	467, 504, 596, 653, 689, 848, 923, 1033
NmuCI	GTSAC	2 cut(s)	786, 874
NsiI	ATGCAT	1 cut(s)	502
NspI	RCATGY	1 cut(s)	504
PaeI	GCATGC	1 cut(s)	504
PaeR7I	CTCGAG	1 cut(s)	908
PctI	GAATGC	2 cut(s)	434, 804
PdmI	GAANNNNTTC	2 cut(s)	295, 298
PfeI	GAWTC	3 cut(s)	48, 321, 924
PflMI	CCANNNNNTGG	1 cut(s)	224
PkrI	GCNGC	1 cut(s)	362
PleI	GAGTC	5 cut(s)	35, 461, 901, 984, 1077
PpsI	GAGTC	5 cut(s)	35, 461, 901, 984, 1077
Psp6I	CCWGG	1 cut(s)	243
PspGI	CCWGG	1 cut(s)	243
PspPI	GGNCC	1 cut(s)	230
PspXI	VCTCGAGB	1 cut(s)	908
RseI	CAYNNNNRTG	2 cut(s)	849, 1008
SaqAI	TTAA	4 cut(s)	345, 526, 807, 916
SatI	GCNGC	1 cut(s)	361
Sau3AI	GATC	2 cut(s)	479, 611
Sau96I	GGNCC	1 cut(s)	230
SchI	GAGTC	5 cut(s)	36, 461, 902, 984, 1078
ScrFI	CCNGG	2 cut(s)	147, 245
SduI	GDGCHC	1 cut(s)	1020
SetI	ASST	5 cut(s)	217, 334, 560, 915, 1041
SfaNI	GCATC	2 cut(s)	76, 487
SfcI	CTRYAG	1 cut(s)	743
Sfr274I	CTCGAG	1 cut(s)	908
SlaI	CTCGAG	1 cut(s)	908
SmiMI	CAYNNNNRTG	2 cut(s)	849, 1008
SmlI	CTYRAG	3 cut(s)	525, 806, 908
SmoI	CTYRAG	3 cut(s)	525, 806, 908
SphI	GCATGC	1 cut(s)	504
Sse9I	AATT	5 cut(s)	371, 414, 518, 702, 959
SsiI	CCGC	3 cut(s)	24, 228, 504
SspI	AATATT	2 cut(s)	133, 440
SspMI	CTAG	2 cut(s)	273, 1082
StyD4I	CCNGG	2 cut(s)	145, 243
TaiI	ACGT	2 cut(s)	217, 560
TaqI	TCGA	2 cut(s)	251, 909
TaqII	GACCGA	1 cut(s)	372
TasI	AATT	5 cut(s)	371, 414, 518, 702, 959
TfiI	GAWTC	3 cut(s)	48, 321, 924
Tru1I	TTAA	4 cut(s)	345, 526, 807, 916
Tru9I	TTAA	4 cut(s)	345, 526, 807, 916
TscAI	CASTG	4 cut(s)	309, 761, 791, 1010
TseFI	GTSAC	2 cut(s)	786, 874
TseI	GCWGC	1 cut(s)	360
Tsp45I	GTSAC	2 cut(s)	786, 874
TspDTI	ATGAA	7 cut(s)	441, 531, 555, 586, 745, 778, 784
TspGWI	ACGGA	2 cut(s)	126, 676
TspRI	CASTG	4 cut(s)	309, 761, 791, 1010
Van91I	CCANNNNNTGG	1 cut(s)	224
Vha464I	CTTAAG	2 cut(s)	525, 806
XapI	RAATTY	3 cut(s)	414, 518, 959
XceI	RCATGY	1 cut(s)	504
XhoI	CTCGAG	1 cut(s)	908
XmnI	GAANNNNTTC	2 cut(s)	295, 298
XspI	CTAG	2 cut(s)	273, 1082
ZraI	GACGTC	1 cut(s)	215
Zsp2I	ATGCAT	1 cut(s)	502

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.