Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0022473.1

Orthogroup ID

OG0007048

Physical Location & Seq

Genomic Coordinates Forward (+)

2577 .. 3010

Gene Structure 434 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0022473.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

atgcgtttgagagctatagcaaattttgctcgcaatagcttactcttcactgcaaaaaccaccaccaccaccagaagcaagaaccatttgaatttcagggtccccttcttcatcagaaaccacaccatgtctggttcagatcaatccccttctttcgacacacccagaatggtggtcaagaaggtcctggccaagtcccagagtgagggtgatggagctgttgtcagaagagccattggaatctctgagttgaggaacctggatccgtttctcatgctagataactttacaggtatataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0004857 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0005886 GO:0006950 GO:0006952 GO:0007154 GO:0007165 GO:0008150 GO:0009314 GO:0009416 GO:0009605 GO:0009607 GO:0009617 GO:0009628 GO:0009637 GO:0009719 GO:0009725 GO:0009737 GO:0009738 GO:0009755 GO:0009785 GO:0009892 GO:0009987 GO:0010033 GO:0010466 GO:0010605 GO:0016020 GO:0019222 GO:0023052 GO:0030162 GO:0030234 GO:0030414 GO:0030522 GO:0031323 GO:0031324 GO:0032268 GO:0032269 GO:0032870 GO:0033993 GO:0042221 GO:0042742 GO:0043086 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044092 GO:0044424 GO:0044444 GO:0044464 GO:0045861 GO:0048519 GO:0048523 GO:0050789 GO:0050790 GO:0050794 GO:0050896 GO:0051171 GO:0051172 GO:0051246 GO:0051248 GO:0051336 GO:0051346 GO:0051704 GO:0051707 GO:0051716 GO:0052547 GO:0060255 GO:0061134 GO:0065007 GO:0065009 GO:0070887 GO:0071214 GO:0071215 GO:0071229 GO:0071310 GO:0071396 GO:0071478 GO:0071482 GO:0071483 GO:0071495 GO:0071944 GO:0080090 GO:0097305 GO:0097306 GO:0098542 GO:0098772 GO:0104004 GO:1901700 GO:1901701

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pirin Pirin_C

Protein Analysis

99

Amino Acids

11.13

Weight (kDa)

11.44

Isoelectric Point (pI)

47.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007048)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G43120 AT2G43120 AT3G59220 AT3G59260
fragaria_vesca	FvH4_4g11770 FvH4_4g11770 FvH4_4g11770 FvH4_4g11770
malus_domestica	MD04G1033300.v1.1
prunus_persica	Prupe.1G181100_v2.0.a1
pyrus_communis	pycom04g02740 pycom04g02780
rosa_chinensis	RchiOBHm_Chr4g0409021
rosa_laevigata	RLG00000008595
rosa_multiflora	Rmu_sc0000121.1_g000003 Rmu_sc0006766.1_g000003 Rmu_sc0017774.1_g000001 Rmu_sc0022473.1_g000002 Rmu_sc0026065.1_g000003
rosa_roxburghii	Rroxscaffold_5G00353500
rosa_rugosa	Rorug04G0089800
rosa_samantha	Rh4AG153500 Rh4BG151600 Rh4CG162000 Rh4DG146900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	257, 270
AcoI	YGGCCR	1 cut(s)	189
AcsI	RAATTY	2 cut(s)	22, 91
AfiI	CCNNNNNNNGG	1 cut(s)	205
AgsI	TTSAA	1 cut(s)	91
AjnI	CCWGG	2 cut(s)	186, 258
AluBI	AGCT	3 cut(s)	14, 39, 218
AluI	AGCT	3 cut(s)	14, 39, 218
AlwI	GGATC	2 cut(s)	257, 270
AoxI	GGCC	1 cut(s)	189
ApoI	RAATTY	2 cut(s)	22, 91
AspS9I	GGNCC	2 cut(s)	100, 184
AsuHPI	GGTGA	1 cut(s)	221
AvaII	GGWCC	2 cut(s)	100, 184
BalI	TGGCCA	1 cut(s)	191
BamHI	GGATCC	1 cut(s)	262
BccI	CCATC	1 cut(s)	206
BciT130I	CCWGG	2 cut(s)	188, 260
BfaI	CTAG	1 cut(s)	278
BfmI	CTRYAG	1 cut(s)	15
Bme1390I	CCNGG	2 cut(s)	188, 260
Bme18I	GGWCC	2 cut(s)	100, 184
BmgT120I	GGNCC	2 cut(s)	100, 184
BmiI	GGNNCC	4 cut(s)	101, 102, 257, 264
BmrFI	CCNGG	2 cut(s)	188, 260
BsaXI	ACNNNNNCTCC	2 cut(s)	207, 237
Bsc4I	CCNNNNNNNGG	1 cut(s)	205
BseBI	CCWGG	2 cut(s)	188, 260
BseLI	CCNNNNNNNGG	1 cut(s)	205
BseMII	CTCAG	1 cut(s)	237
BshFI	GGCC	1 cut(s)	191
BslFI	GGGAC	2 cut(s)	86, 181
BslI	CCNNNNNNNGG	1 cut(s)	205
BsmFI	GGGAC	2 cut(s)	86, 181
BsnI	GGCC	1 cut(s)	191
Bsp143I	GATC	2 cut(s)	139, 262
BspANI	GGCC	1 cut(s)	191
BspCNI	CTCAG	1 cut(s)	238
BspLI	GGNNCC	4 cut(s)	101, 102, 257, 264
BspPI	GGATC	2 cut(s)	257, 270
BspQI	GCTCTTC	1 cut(s)	223
BssMI	GATC	2 cut(s)	139, 262
Bst2UI	CCWGG	2 cut(s)	188, 260
Bst6I	CTCTTC	2 cut(s)	50, 223
BstAPI	GCANNNNNTGC	1 cut(s)	26
BstC8I	GCNNGC	1 cut(s)	31
BstDEI	CTNAG	1 cut(s)	246
BstKTI	GATC	2 cut(s)	142, 265
BstMBI	GATC	2 cut(s)	139, 262
BstMWI	GCNNNNNNNGC	1 cut(s)	26
BstNI	CCWGG	2 cut(s)	188, 260
BstSCI	CCNGG	2 cut(s)	186, 258
BstSFI	CTRYAG	1 cut(s)	15
BstX2I	RGATCY	1 cut(s)	262
BstXI	CCANNNNNNTGG	1 cut(s)	172
BstYI	RGATCY	1 cut(s)	262
BsuRI	GGCC	1 cut(s)	191
BtsI	GCAGTG	1 cut(s)	48
BtsIMutI	CAGTG	1 cut(s)	48
Cac8I	GCNNGC	1 cut(s)	31
Cfr13I	GGNCC	2 cut(s)	100, 184
CviAII	CATG	2 cut(s)	127, 274
CviJI	RGCY	5 cut(s)	14, 39, 191, 218, 233
CviKI_1	RGCY	5 cut(s)	14, 39, 191, 218, 233
DdeI	CTNAG	1 cut(s)	246
DpnI	GATC	2 cut(s)	141, 264
DpnII	GATC	2 cut(s)	139, 262
EaeI	YGGCCR	1 cut(s)	189
Eam1104I	CTCTTC	2 cut(s)	50, 223
EarI	CTCTTC	2 cut(s)	50, 223
Eco47I	GGWCC	2 cut(s)	100, 184
EcoO109I	RGGNCCY	2 cut(s)	100, 184
EcoRII	CCWGG	2 cut(s)	186, 258
FaeI	CATG	2 cut(s)	130, 277
FaiI	YATR	5 cut(s)	17, 128, 275, 296, 298
FaqI	GGGAC	2 cut(s)	86, 181
FatI	CATG	2 cut(s)	126, 273
FspBI	CTAG	1 cut(s)	278
HaeIII	GGCC	1 cut(s)	191
Hin1II	CATG	2 cut(s)	130, 277
HinfI	GANTC	1 cut(s)	240
HphI	GGTGA	1 cut(s)	221
Hpy188I	TCNGA	4 cut(s)	116, 139, 227, 247
Hpy188III	TCNNGA	1 cut(s)	178
HpyAV	CCTTC	3 cut(s)	115, 159, 175
HpyCH4V	TGCA	1 cut(s)	53
HpyF10VI	GCNNNNNNNGC	1 cut(s)	26
HpyF3I	CTNAG	1 cut(s)	246
Hsp92II	CATG	2 cut(s)	130, 277
KflI	GGGWCCC	1 cut(s)	100
Kzo9I	GATC	2 cut(s)	139, 262
LguI	GCTCTTC	1 cut(s)	223
LmnI	GCTCC	1 cut(s)	215
MaeI	CTAG	1 cut(s)	278
MalI	GATC	2 cut(s)	141, 264
MboI	GATC	2 cut(s)	139, 262
MboII	GAAGA	3 cut(s)	37, 100, 240
MflI	RGATCY	1 cut(s)	262
MlsI	TGGCCA	1 cut(s)	191
MluCI	AATT	2 cut(s)	22, 91
MluNI	TGGCCA	1 cut(s)	191
MnlI	CCTC	2 cut(s)	199, 246
Mox20I	TGGCCA	1 cut(s)	191
MscI	TGGCCA	1 cut(s)	191
Msp20I	TGGCCA	1 cut(s)	191
MspR9I	CCNGG	2 cut(s)	188, 260
MvaI	CCWGG	2 cut(s)	188, 260
MwoI	GCNNNNNNNGC	1 cut(s)	26
NdeII	GATC	2 cut(s)	139, 262
NlaIII	CATG	2 cut(s)	130, 277
NlaIV	GGNNCC	4 cut(s)	101, 102, 257, 264
PciSI	GCTCTTC	1 cut(s)	223
PfeI	GAWTC	1 cut(s)	240
PpuMI	RGGWCCY	2 cut(s)	100, 184
Psp5II	RGGWCCY	2 cut(s)	100, 184
Psp6I	CCWGG	2 cut(s)	186, 258
PspGI	CCWGG	2 cut(s)	186, 258
PspN4I	GGNNCC	4 cut(s)	101, 102, 257, 264
PspPI	GGNCC	2 cut(s)	100, 184
PspPPI	RGGWCCY	2 cut(s)	100, 184
PsuI	RGATCY	1 cut(s)	262
SapI	GCTCTTC	1 cut(s)	223
Sau3AI	GATC	2 cut(s)	139, 262
Sau96I	GGNCC	2 cut(s)	100, 184
ScrFI	CCNGG	2 cut(s)	188, 260
SetI	ASST	6 cut(s)	16, 41, 186, 220, 261, 295
SfcI	CTRYAG	1 cut(s)	15
SinI	GGWCC	2 cut(s)	100, 184
Sse9I	AATT	2 cut(s)	22, 91
SspMI	CTAG	1 cut(s)	278
StyD4I	CCNGG	2 cut(s)	186, 258
TaqI	TCGA	1 cut(s)	156
TasI	AATT	2 cut(s)	22, 91
TfiI	GAWTC	1 cut(s)	240
TscAI	CASTG	1 cut(s)	55
TspDTI	ATGAA	1 cut(s)	100
TspGWI	ACGGA	1 cut(s)	255
TspRI	CASTG	1 cut(s)	55
VpaK11BI	GGWCC	2 cut(s)	100, 184
XapI	RAATTY	2 cut(s)	22, 91
XcmI	CCANNNNNNNNNTGG	1 cut(s)	128
XspI	CTAG	1 cut(s)	278

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.