Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0026766.1

Orthogroup ID

OG0015627

Physical Location & Seq

Genomic Coordinates Forward (+)

639 .. 959

Gene Structure 321 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0026766.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 321 bp

atggaaacagatgagaatggtaatgaggagattgatggggctacattcgaatccatggaaacatatatggccatgaccatcccaacaagtaaatcagcgatagaggatttgaagaaagtgagattcgagagtgtggaaattgcgagacatgctgggttatgtagtatttgtttggaggactttaaagccgtagttgaagctactcgcttgccttgcttacatttttttcatggagattgcgttgttcggtggctggagatcaatcatcaatgccccttgtgccgatttccaatgcgtcatgatggaacatcaatctattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0000902 GO:0000904 GO:0003006 GO:0003674 GO:0003824 GO:0004842 GO:0006464 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0009653 GO:0009791 GO:0009826 GO:0009888 GO:0009987 GO:0010026 GO:0010154 GO:0016043 GO:0016049 GO:0016567 GO:0016740 GO:0019538 GO:0019787 GO:0022412 GO:0022414 GO:0030154 GO:0032446 GO:0032501 GO:0032502 GO:0032504 GO:0032989 GO:0036211 GO:0040007 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0048316 GO:0048468 GO:0048589 GO:0048608 GO:0048731 GO:0048856 GO:0048869 GO:0060560 GO:0061458 GO:0070647 GO:0071704 GO:0071840 GO:0090376 GO:0090378 GO:0090558 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-RING_2

Protein Analysis

106

Amino Acids

12.11

Weight (kDa)

4.97

Isoelectric Point (pI)

42.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015627)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g14420
rosa_chinensis	RchiOBHm_Chr4g0407861 RchiOBHm_Chr7g0182241
rosa_laevigata	RLG00000005137
rosa_multiflora	Rmu_sc0000003.1_g000011 Rmu_sc0026766.1_g000001
rosa_roxburghii	Rroxscaffold_3G00271390
rosa_rugosa	Rorug06G0446400
rosa_samantha	Rh4CG153400 Rh4DG140900 Rh7AG049400 Rh7BG049500 Rh7CG050800 Rh7DG048700
rosa_wichuraiana	Rw4G012060 Rw7G004050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	69
AgsI	TTSAA	2 cut(s)	112, 197
AluBI	AGCT	1 cut(s)	200
AluI	AGCT	1 cut(s)	200
Alw26I	GTCTC	1 cut(s)	139
AoxI	GGCC	1 cut(s)	69
AsuII	TTCGAA	1 cut(s)	48
BalI	TGGCCA	1 cut(s)	71
BccI	CCATC	3 cut(s)	29, 86, 296
BceAI	ACGGC	1 cut(s)	173
BcoDI	GTCTC	1 cut(s)	139
BpmI	CTGGAG	1 cut(s)	275
Bpu14I	TTCGAA	1 cut(s)	48
BsaJI	CCNNGG	1 cut(s)	54
BsaXI	ACNNNNNCTCC	2 cut(s)	225, 255
BseDI	CCNNGG	1 cut(s)	54
BseGI	GGATG	1 cut(s)	78
BseRI	GAGGAG	1 cut(s)	41
BseYI	CCCAGC	1 cut(s)	152
BshFI	GGCC	1 cut(s)	71
BsmAI	GTCTC	1 cut(s)	139
BsnI	GGCC	1 cut(s)	71
Bsp119I	TTCGAA	1 cut(s)	48
Bsp143I	GATC	1 cut(s)	258
Bsp19I	CCATGG	1 cut(s)	54
BspANI	GGCC	1 cut(s)	71
BspHI	TCATGA	1 cut(s)	298
BspT104I	TTCGAA	1 cut(s)	48
BssECI	CCNNGG	1 cut(s)	54
BssMI	GATC	1 cut(s)	258
BssT1I	CCWWGG	1 cut(s)	54
BstBI	TTCGAA	1 cut(s)	48
BstC8I	GCNNGC	1 cut(s)	209
BstDSI	CCRYGG	1 cut(s)	54
BstF5I	GGATG	1 cut(s)	78
BstKTI	GATC	1 cut(s)	261
BstMAI	GTCTC	1 cut(s)	139
BstMBI	GATC	1 cut(s)	258
BstMWI	GCNNNNNNNGC	3 cut(s)	149, 213, 279
BstNSI	RCATGY	1 cut(s)	152
BsuRI	GGCC	1 cut(s)	71
BtgI	CCRYGG	1 cut(s)	54
BtsCI	GGATG	1 cut(s)	78
Cac8I	GCNNGC	1 cut(s)	209
CciI	TCATGA	1 cut(s)	298
CseI	GACGC	1 cut(s)	284
CviAII	CATG	5 cut(s)	55, 73, 149, 230, 299
CviJI	RGCY	5 cut(s)	41, 71, 188, 200, 253
CviKI_1	RGCY	5 cut(s)	41, 71, 188, 200, 253
DpnI	GATC	1 cut(s)	260
DpnII	GATC	1 cut(s)	258
DraI	TTTAAA	1 cut(s)	184
EaeI	YGGCCR	1 cut(s)	69
Eco130I	CCWWGG	1 cut(s)	54
EcoT14I	CCWWGG	1 cut(s)	54
ErhI	CCWWGG	1 cut(s)	54
FaeI	CATG	5 cut(s)	58, 76, 152, 233, 302
FaiI	YATR	9 cut(s)	56, 64, 66, 68, 74, 150, 160, 231, 300
FatI	CATG	5 cut(s)	54, 72, 148, 229, 298
FokI	GGATG	1 cut(s)	65
GsaI	CCCAGC	1 cut(s)	156
GsuI	CTGGAG	1 cut(s)	275
HaeIII	GGCC	1 cut(s)	71
HgaI	GACGC	1 cut(s)	284
Hin1II	CATG	5 cut(s)	58, 76, 152, 233, 302
HinfI	GANTC	2 cut(s)	50, 123
Hpy188III	TCNNGA	2 cut(s)	127, 299
HpyF10VI	GCNNNNNNNGC	3 cut(s)	149, 213, 279
Hsp92II	CATG	5 cut(s)	58, 76, 152, 233, 302
Kzo9I	GATC	1 cut(s)	258
LpnPI	CCDG	2 cut(s)	138, 239
MalI	GATC	1 cut(s)	260
MboI	GATC	1 cut(s)	258
MboII	GAAGA	1 cut(s)	124
MlsI	TGGCCA	1 cut(s)	71
MluCI	AATT	1 cut(s)	138
MluNI	TGGCCA	1 cut(s)	71
MnlI	CCTC	3 cut(s)	19, 97, 169
Mox20I	TGGCCA	1 cut(s)	71
MscI	TGGCCA	1 cut(s)	71
MseI	TTAA	2 cut(s)	183, 319
Msp20I	TGGCCA	1 cut(s)	71
MwoI	GCNNNNNNNGC	3 cut(s)	149, 213, 279
NcoI	CCATGG	1 cut(s)	54
NdeII	GATC	1 cut(s)	258
NlaIII	CATG	5 cut(s)	58, 76, 152, 233, 302
NspI	RCATGY	1 cut(s)	152
NspV	TTCGAA	1 cut(s)	48
PagI	TCATGA	1 cut(s)	298
PfeI	GAWTC	2 cut(s)	50, 123
PspFI	CCCAGC	1 cut(s)	152
SaqAI	TTAA	2 cut(s)	183, 319
Sau3AI	GATC	1 cut(s)	258
SetI	ASST	1 cut(s)	202
SfuI	TTCGAA	1 cut(s)	48
Sse9I	AATT	1 cut(s)	138
StyI	CCWWGG	1 cut(s)	54
TaqI	TCGA	2 cut(s)	48, 126
TasI	AATT	1 cut(s)	138
TfiI	GAWTC	2 cut(s)	50, 123
Tru1I	TTAA	2 cut(s)	183, 319
Tru9I	TTAA	2 cut(s)	183, 319
TspDTI	ATGAA	1 cut(s)	218
XceI	RCATGY	1 cut(s)	152

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.