Rh7DG048700
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
3746888 .. 3748100
1213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG048700.1

Sequence Viewer

Length: 441 bp
ATGGGTGTTCCACGGCAGGTGCAGCAAACTATTGTTGCAAAGATATCTGAGTTTCTTGTTCTTGGGAATATGGACCGCACCGCTAATAATGATAATGATGATAGCGAGATCGAATGTGGAGATCCTTTGGATGCAATGTTAGCCAGGTTATATTATGATATTAATCATGTGGATGCGGCGGTTATCAGTATCCATGAGTTGCTTCAAAGGAATCTTCCTACGTTCACAGAAACAAATGATGATCATCATATTAAGGATTTTCAGCTGATGAACTATAGGGATATTGAGGCGGCTGATCAGTATCATAATCGACCACCTCATGAATATCCCTATAATTCGTCCGCTGATCATGATACTGAGGATGAAGATCATTTTGTGCTGGACGAATTGCTAATGGAAACATATGATAATGGTAATGAGGAGGTCGTCTATGACTCCTAA

Protein Analysis

146

Amino Acids

16.92

Weight (kDa)

4.18

Isoelectric Point (pI)

45.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 7
Acc36I ACCTGC 1 cut(s) 7
AciI CCGC 6 cut(s) 76, 81, 176, 179, 290, 342
AclWI GGATC 1 cut(s) 116
AgsI TTSAA 1 cut(s) 206
AjnI CCWGG 1 cut(s) 143
AluBI AGCT 1 cut(s) 265
AluI AGCT 1 cut(s) 265
AlwI GGATC 1 cut(s) 116
ApeKI GCWGC 1 cut(s) 22
AseI ATTAAT 1 cut(s) 162
AspS9I GGNCC 1 cut(s) 73
AvaII GGWCC 1 cut(s) 73
BbvI GCAGC 1 cut(s) 34
BceAI ACGGC 1 cut(s) 29
BciT130I CCWGG 1 cut(s) 145
BciVI GTATCC 1 cut(s) 200
BclI TGATCA 3 cut(s) 241, 295, 346
BfmI CTRYAG 1 cut(s) 274
BfuAI ACCTGC 1 cut(s) 7
BfuI GTATCC 1 cut(s) 200
BisI GCNGC 3 cut(s) 23, 177, 291
BlsI GCNGC 3 cut(s) 24, 178, 292
Bme1390I CCNGG 1 cut(s) 145
Bme18I GGWCC 1 cut(s) 73
BmgT120I GGNCC 1 cut(s) 73
BmrFI CCNGG 1 cut(s) 145
BmsI GCATC 2 cut(s) 121, 163
BsaBI GATNNNNATC 4 cut(s) 162, 243, 300, 366
BsaJI CCNNGG 1 cut(s) 11
Bse3DI GCAATG 1 cut(s) 141
Bse8I GATNNNNATC 4 cut(s) 162, 243, 300, 366
BseBI CCWGG 1 cut(s) 145
BseDI CCNNGG 1 cut(s) 11
BseGI GGATG 3 cut(s) 136, 178, 367
BseJI GATNNNNATC 4 cut(s) 162, 243, 300, 366
BseMI GCAATG 1 cut(s) 141
BseMII CTCAG 2 cut(s) 39, 348
BseRI GAGGAG 1 cut(s) 434
BseXI GCAGC 1 cut(s) 34
BsgI GTGCAG 1 cut(s) 41
Bsp143I GATC 6 cut(s) 108, 121, 241, 295, 346, 367
BspACI CCGC 6 cut(s) 76, 81, 176, 179, 290, 342
BspCNI CTCAG 2 cut(s) 40, 349
BspHI TCATGA 2 cut(s) 319, 349
BspMI ACCTGC 1 cut(s) 7
BspPI GGATC 1 cut(s) 116
BsrDI GCAATG 1 cut(s) 141
BssECI CCNNGG 1 cut(s) 11
BssMI GATC 6 cut(s) 108, 121, 241, 295, 346, 367
Bst2UI CCWGG 1 cut(s) 145
BstDEI CTNAG 2 cut(s) 48, 357
BstDSI CCRYGG 1 cut(s) 11
BstF5I GGATG 3 cut(s) 136, 178, 367
BstKTI GATC 6 cut(s) 111, 124, 244, 298, 349, 370
BstMBI GATC 6 cut(s) 108, 121, 241, 295, 346, 367
BstMWI GCNNNNNNNGC 2 cut(s) 22, 140
BstNI CCWGG 1 cut(s) 145
BstSCI CCNGG 1 cut(s) 143
BstSFI CTRYAG 1 cut(s) 274
BstV1I GCAGC 1 cut(s) 34
BstX2I RGATCY 1 cut(s) 121
BstYI RGATCY 1 cut(s) 121
BsuI GTATCC 1 cut(s) 200
BtgI CCRYGG 1 cut(s) 11
BtsCI GGATG 3 cut(s) 136, 178, 367
BveI ACCTGC 1 cut(s) 7
CciI TCATGA 2 cut(s) 319, 349
Cfr13I GGNCC 1 cut(s) 73
CviAII CATG 4 cut(s) 167, 194, 320, 350
CviJI RGCY 3 cut(s) 143, 265, 293
CviKI_1 RGCY 3 cut(s) 143, 265, 293
DdeI CTNAG 2 cut(s) 48, 357
DpnI GATC 6 cut(s) 110, 123, 243, 297, 348, 369
DpnII GATC 6 cut(s) 108, 121, 241, 295, 346, 367
Eco32I GATATC 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 73
EcoRII CCWGG 1 cut(s) 143
EcoRV GATATC 1 cut(s) 45
FaeI CATG 4 cut(s) 170, 197, 323, 353
FatI CATG 4 cut(s) 166, 193, 319, 349
FauNDI CATATG 1 cut(s) 403
FbaI TGATCA 3 cut(s) 241, 295, 346
Fnu4HI GCNGC 3 cut(s) 23, 177, 291
FokI GGATG 3 cut(s) 143, 185, 374
Fsp4HI GCNGC 3 cut(s) 23, 177, 291
GluI GCNGC 3 cut(s) 23, 177, 291
Hin1II CATG 4 cut(s) 170, 197, 323, 353
HinfI GANTC 2 cut(s) 211, 434
Hpy166II GTNNAC 1 cut(s) 225
Hpy188I TCNGA 1 cut(s) 49
Hpy188III TCNNGA 2 cut(s) 320, 350
Hpy8I GTNNAC 1 cut(s) 225
HpyCH4IV ACGT 1 cut(s) 221
HpyCH4V TGCA 3 cut(s) 22, 38, 134
HpyF10VI GCNNNNNNNGC 2 cut(s) 22, 140
HpyF3I CTNAG 2 cut(s) 48, 357
HpySE526I ACGT 1 cut(s) 221
Hsp92II CATG 4 cut(s) 170, 197, 323, 353
Ksp22I TGATCA 3 cut(s) 241, 295, 346
Kzo9I GATC 6 cut(s) 108, 121, 241, 295, 346, 367
LpnPI CCDG 4 cut(s) 2, 130, 157, 365
Lsp1109I GCAGC 1 cut(s) 34
LweI GCATC 2 cut(s) 121, 163
MaeII ACGT 1 cut(s) 221
MalI GATC 6 cut(s) 110, 123, 243, 297, 348, 369
MboI GATC 6 cut(s) 108, 121, 241, 295, 346, 367
MboII GAAGA 2 cut(s) 206, 377
MflI RGATCY 1 cut(s) 121
MluCI AATT 2 cut(s) 334, 386
MlyI GAGTC 1 cut(s) 428
MnlI CCTC 5 cut(s) 280, 327, 352, 412, 415
MseI TTAA 2 cut(s) 162, 252
MslI CAYNNNNRTG 1 cut(s) 171
MspA1I CMGCKG 2 cut(s) 265, 344
MspR9I CCNGG 1 cut(s) 145
MvaI CCWGG 1 cut(s) 145
MwoI GCNNNNNNNGC 2 cut(s) 22, 140
NdeI CATATG 1 cut(s) 403
NdeII GATC 6 cut(s) 108, 121, 241, 295, 346, 367
NlaIII CATG 4 cut(s) 170, 197, 323, 353
PagI TCATGA 2 cut(s) 319, 349
PaqCI CACCTGC 1 cut(s) 7
PfeI GAWTC 1 cut(s) 211
PkrI GCNGC 3 cut(s) 24, 178, 292
PleI GAGTC 1 cut(s) 428
PpsI GAGTC 1 cut(s) 428
PshBI ATTAAT 1 cut(s) 162
Psp6I CCWGG 1 cut(s) 143
PspGI CCWGG 1 cut(s) 143
PspPI GGNCC 1 cut(s) 73
PsuI RGATCY 1 cut(s) 121
PvuII CAGCTG 1 cut(s) 265
RseI CAYNNNNRTG 1 cut(s) 171
SaqAI TTAA 2 cut(s) 162, 252
SatI GCNGC 3 cut(s) 23, 177, 291
Sau3AI GATC 6 cut(s) 108, 121, 241, 295, 346, 367
Sau96I GGNCC 1 cut(s) 73
SchI GAGTC 1 cut(s) 428
ScrFI CCNGG 1 cut(s) 145
SetI ASST 6 cut(s) 21, 149, 224, 267, 319, 426
SfaNI GCATC 2 cut(s) 121, 163
SfcI CTRYAG 1 cut(s) 274
SinI GGWCC 1 cut(s) 73
SmiMI CAYNNNNRTG 1 cut(s) 171
Sse9I AATT 2 cut(s) 334, 386
SsiI CCGC 6 cut(s) 76, 81, 176, 179, 290, 342
StyD4I CCNGG 1 cut(s) 143
TaiI ACGT 1 cut(s) 224
TaqI TCGA 2 cut(s) 111, 310
TasI AATT 2 cut(s) 334, 386
TauI GCSGC 2 cut(s) 179, 293
TfiI GAWTC 1 cut(s) 211
Tru1I TTAA 2 cut(s) 162, 252
Tru9I TTAA 2 cut(s) 162, 252
TseI GCWGC 1 cut(s) 22
TspDTI ATGAA 3 cut(s) 284, 336, 378
VpaK11BI GGWCC 1 cut(s) 73
VspI ATTAAT 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.