Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0027246.1

Orthogroup ID

OG0004761

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1488

Gene Structure 1488 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0027246.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 400 bp

gacttcgattgttctaggcacaagtataccacttattttatttctagtctggaatgctgtgattctaggaaccatcacagatgttgaaatgggctctggtaaaatcatggatccattacaactattgcaatcaacaaatgctgctgttggacctatagttgaggtgttctcaatttttgctatcgcgacgtcatatattggatttgttttgggtctttgtgatttcctttctgatctgctgaaactcccggctggtcagagcaggcctgtgttgccataccttttaacgttgattccaccagttgtgctgtcattgctagacccagatatattctttaaagccttggactttgctggaacttatggaggtgtggccatttttcatttttccggaacttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Trp_Tyr_perm

Protein Analysis

132

Amino Acids

14.01

Weight (kDa)

4.27

Isoelectric Point (pI)

26.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004761)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G19500
fragaria_vesca	FvH4_3g27580 FvH4_3g27580 FvH4_3g27580 FvH4_3g27580 FvH4_3g27580 FvH4_3g27580 FvH4_3g27580 FvH4_3g27580 FvH4_3g27580 FvH4_3g27580 FvH4_3g27580 FvH4_3g27580 FvH4_3g27580 FvH4_3g27580
malus_domestica	MD03G1163200.v1.1 MD03G1163300.v1.1
prunus_persica	Prupe.4G269300_v2.0.a1
pyrus_communis	pycom5153684g00190
rosa_chinensis	RchiOBHm_Chr5g0050121
rosa_laevigata	RLG00000034687
rosa_multiflora	Rmu_sc0002289.1_g000011 Rmu_sc0027246.1_g000001
rosa_roxburghii	Rroxscaffold_1G00031040
rosa_rugosa	Rorug05G0258900
rosa_samantha	Rh5AG330600 Rh5BG341300 Rh5BG341400 Rh5CG367900 Rh5DG354100
rosa_wichuraiana	Rw5G031250

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	192
AccI	GTMKAC	1 cut(s)	26
AccII	CGCG	1 cut(s)	186
AccIII	TCCGGA	1 cut(s)	390
AclI	AACGTT	1 cut(s)	288
AclWI	GGATC	2 cut(s)	105, 118
AcoI	YGGCCR	1 cut(s)	373
AcyI	GRCGYC	1 cut(s)	189
AgsI	TTSAA	1 cut(s)	87
AlwI	GGATC	2 cut(s)	105, 118
Aor13HI	TCCGGA	1 cut(s)	390
AoxI	GGCC	2 cut(s)	264, 373
ApeKI	GCWGC	1 cut(s)	141
AspS9I	GGNCC	1 cut(s)	150
AsuC2I	CCSGG	1 cut(s)	249
AvaII	GGWCC	1 cut(s)	150
BalI	TGGCCA	1 cut(s)	375
BamHI	GGATCC	1 cut(s)	110
BanII	GRGCYC	1 cut(s)	96
BbvI	GCAGC	1 cut(s)	128
BccI	CCATC	1 cut(s)	81
BcnI	CCSGG	1 cut(s)	249
BfaI	CTAG	4 cut(s)	15, 45, 66, 318
BfmI	CTRYAG	1 cut(s)	154
BisI	GCNGC	1 cut(s)	142
BlsI	GCNGC	1 cut(s)	143
Bme1390I	CCNGG	1 cut(s)	249
Bme18I	GGWCC	1 cut(s)	150
BmgT120I	GGNCC	1 cut(s)	150
BmiI	GGNNCC	2 cut(s)	71, 112
BmrFI	CCNGG	1 cut(s)	249
BplI	GAGNNNNNCTC	2 cut(s)	153, 185
BpuMI	CCSGG	1 cut(s)	249
BsaHI	GRCGYC	1 cut(s)	189
BsaJI	CCNNGG	1 cut(s)	343
BsaWI	WCCGGW	1 cut(s)	390
Bse1I	ACTGG	1 cut(s)	300
Bse3DI	GCAATG	1 cut(s)	312
BseAI	TCCGGA	1 cut(s)	390
BseDI	CCNNGG	1 cut(s)	343
BseMI	GCAATG	1 cut(s)	312
BseNI	ACTGG	1 cut(s)	300
BseXI	GCAGC	1 cut(s)	128
Bsh1236I	CGCG	1 cut(s)	186
BshFI	GGCC	2 cut(s)	266, 375
BsiSI	CCGG	2 cut(s)	249, 391
BsmI	GAATGC	1 cut(s)	59
BsnI	GGCC	2 cut(s)	266, 375
Bsp1286I	GDGCHC	1 cut(s)	96
Bsp13I	TCCGGA	1 cut(s)	390
Bsp143I	GATC	2 cut(s)	110, 233
Bsp68I	TCGCGA	1 cut(s)	186
BspANI	GGCC	2 cut(s)	266, 375
BspEI	TCCGGA	1 cut(s)	390
BspFNI	CGCG	1 cut(s)	186
BspLI	GGNNCC	2 cut(s)	71, 112
BspPI	GGATC	2 cut(s)	105, 118
BsrDI	GCAATG	1 cut(s)	312
BsrI	ACTGG	1 cut(s)	300
BssECI	CCNNGG	1 cut(s)	343
BssMI	GATC	2 cut(s)	110, 233
BssNAI	GTATAC	1 cut(s)	27
BssNI	GRCGYC	1 cut(s)	189
BssT1I	CCWWGG	1 cut(s)	343
Bst1107I	GTATAC	1 cut(s)	27
BstACI	GRCGYC	1 cut(s)	189
BstC8I	GCNNGC	1 cut(s)	264
BstDEI	CTNAG	1 cut(s)	397
BstFNI	CGCG	1 cut(s)	186
BstKTI	GATC	2 cut(s)	113, 236
BstMBI	GATC	2 cut(s)	110, 233
BstMWI	GCNNNNNNNGC	2 cut(s)	272, 314
BstSCI	CCNGG	1 cut(s)	247
BstSFI	CTRYAG	1 cut(s)	154
BstUI	CGCG	1 cut(s)	186
BstV1I	GCAGC	1 cut(s)	128
BstX2I	RGATCY	1 cut(s)	110
BstYI	RGATCY	1 cut(s)	110
BstZ17I	GTATAC	1 cut(s)	27
BsuRI	GGCC	2 cut(s)	266, 375
BtuMI	TCGCGA	1 cut(s)	186
Cac8I	GCNNGC	1 cut(s)	264
Cfr13I	GGNCC	1 cut(s)	150
CviAII	CATG	1 cut(s)	107
CviJI	RGCY	5 cut(s)	94, 252, 266, 342, 375
CviKI_1	RGCY	5 cut(s)	94, 252, 266, 342, 375
DdeI	CTNAG	1 cut(s)	397
DpnI	GATC	2 cut(s)	112, 235
DpnII	GATC	2 cut(s)	110, 233
DraI	TTTAAA	1 cut(s)	338
EaeI	YGGCCR	1 cut(s)	373
Eco130I	CCWWGG	1 cut(s)	343
Eco147I	AGGCCT	1 cut(s)	266
Eco24I	GRGCYC	1 cut(s)	96
Eco47I	GGWCC	1 cut(s)	150
EcoT14I	CCWWGG	1 cut(s)	343
EcoT38I	GRGCYC	1 cut(s)	96
ErhI	CCWWGG	1 cut(s)	343
FaeI	CATG	1 cut(s)	110
FaiI	YATR	8 cut(s)	27, 108, 156, 194, 196, 278, 330, 364
FatI	CATG	1 cut(s)	106
FblI	GTMKAC	1 cut(s)	26
Fnu4HI	GCNGC	1 cut(s)	142
FriOI	GRGCYC	1 cut(s)	96
Fsp4HI	GCNGC	1 cut(s)	142
FspBI	CTAG	4 cut(s)	15, 45, 66, 318
GluI	GCNGC	1 cut(s)	142
HaeIII	GGCC	2 cut(s)	266, 375
HapII	CCGG	2 cut(s)	249, 391
Hin1I	GRCGYC	1 cut(s)	189
Hin1II	CATG	1 cut(s)	110
HinfI	GANTC	2 cut(s)	62, 293
HpaII	CCGG	2 cut(s)	249, 391
Hpy166II	GTNNAC	1 cut(s)	27
Hpy188I	TCNGA	2 cut(s)	233, 259
Hpy188III	TCNNGA	3 cut(s)	50, 185, 391
Hpy8I	GTNNAC	1 cut(s)	27
Hpy99I	CGWCG	1 cut(s)	191
HpyCH4IV	ACGT	2 cut(s)	189, 288
HpyCH4V	TGCA	1 cut(s)	128
HpyF10VI	GCNNNNNNNGC	2 cut(s)	272, 314
HpyF3I	CTNAG	1 cut(s)	397
HpySE526I	ACGT	2 cut(s)	189, 288
Hsp92I	GRCGYC	1 cut(s)	189
Hsp92II	CATG	1 cut(s)	110
Kpn2I	TCCGGA	1 cut(s)	390
Kzo9I	GATC	2 cut(s)	110, 233
LpnPI	CCDG	9 cut(s)	35, 82, 238, 248, 262, 280, 313, 337, 340
Lsp1109I	GCAGC	1 cut(s)	128
MaeI	CTAG	4 cut(s)	15, 45, 66, 318
MaeII	ACGT	2 cut(s)	189, 288
MalI	GATC	2 cut(s)	112, 235
MboI	GATC	2 cut(s)	110, 233
MflI	RGATCY	1 cut(s)	110
MhlI	GDGCHC	1 cut(s)	96
MlsI	TGGCCA	1 cut(s)	375
MluCI	AATT	1 cut(s)	172
MluNI	TGGCCA	1 cut(s)	375
MmeI	TCCRAC	1 cut(s)	128
MnlI	CCTC	2 cut(s)	155, 360
Mox20I	TGGCCA	1 cut(s)	375
MroI	TCCGGA	1 cut(s)	390
MscI	TGGCCA	1 cut(s)	375
MseI	TTAA	2 cut(s)	285, 337
Msp20I	TGGCCA	1 cut(s)	375
MspI	CCGG	2 cut(s)	249, 391
MspR9I	CCNGG	1 cut(s)	249
Mva1269I	GAATGC	1 cut(s)	59
MvnI	CGCG	1 cut(s)	186
MwoI	GCNNNNNNNGC	2 cut(s)	272, 314
NciI	CCSGG	1 cut(s)	249
NdeII	GATC	2 cut(s)	110, 233
NlaIII	CATG	1 cut(s)	110
NlaIV	GGNNCC	2 cut(s)	71, 112
NruI	TCGCGA	1 cut(s)	186
PceI	AGGCCT	1 cut(s)	266
PctI	GAATGC	1 cut(s)	59
PfeI	GAWTC	2 cut(s)	62, 293
PkrI	GCNGC	1 cut(s)	143
Psp1406I	AACGTT	1 cut(s)	288
PspN4I	GGNNCC	2 cut(s)	71, 112
PspPI	GGNCC	1 cut(s)	150
PsuI	RGATCY	1 cut(s)	110
RruI	TCGCGA	1 cut(s)	186
SaqAI	TTAA	2 cut(s)	285, 337
SatI	GCNGC	1 cut(s)	142
Sau3AI	GATC	2 cut(s)	110, 233
Sau96I	GGNCC	1 cut(s)	150
ScrFI	CCNGG	1 cut(s)	249
SduI	GDGCHC	1 cut(s)	96
SetI	ASST	6 cut(s)	155, 166, 192, 283, 291, 371
SfcI	CTRYAG	1 cut(s)	154
SinI	GGWCC	1 cut(s)	150
Sse9I	AATT	1 cut(s)	172
SseBI	AGGCCT	1 cut(s)	266
SspMI	CTAG	4 cut(s)	15, 45, 66, 318
StuI	AGGCCT	1 cut(s)	266
StyD4I	CCNGG	1 cut(s)	247
StyI	CCWWGG	1 cut(s)	343
TaiI	ACGT	2 cut(s)	192, 291
TaqI	TCGA	1 cut(s)	6
TasI	AATT	1 cut(s)	172
TfiI	GAWTC	2 cut(s)	62, 293
Tru1I	TTAA	2 cut(s)	285, 337
Tru9I	TTAA	2 cut(s)	285, 337
TseI	GCWGC	1 cut(s)	141
TspDTI	ATGAA	1 cut(s)	372
VpaK11BI	GGWCC	1 cut(s)	150
XmiI	GTMKAC	1 cut(s)	26
XspI	CTAG	4 cut(s)	15, 45, 66, 318
ZraI	GACGTC	1 cut(s)	190

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.