Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0027699.1

Orthogroup ID

OG0002043

Physical Location & Seq

Genomic Coordinates Reverse (-)

767 .. 2350

Gene Structure 1584 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0027699.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1083 bp

atgatcgtccaacaaatgtacgtggaaaaacgccacaagccaatgaagccggagagccagtacgaggttgtgtgggttccgattgtggacacatggaccgaagacaagtacgaacagttcgagaggattagaaattgtatggaatggtactcggtttacctcccttccgtagtttcgccgactgtgatcaggtacatccgaaaggaggataaatggaactttgtgaagaagcctttgcttgtggtgatggaccctcaaggtaaaatagtgcacaccaatgctgtacacatgatgtgtgtttttggaagcatagcatttccattcaataaaaacagggaggaagtgctctgggaagaggagacctggagaattgaacttgtggcagactccatcgatgagaacttaatttcttggatcaccgaaaggaaatacatttgcttgtacggtggagaagacataaaatggatccggagtttcacaagggcggcaagaagtgtggcttgggaagctggaatccggttggaattgctttacgtgggcaagaggaaggctacggagaaagtggtgaagaacataatgagaatcattcaagacgagaatctaagccacacgatcgagtggcaattcatttcgttgttctggactcgtctagaaagcatgtgggaatccaaaggacatcaactccagaacaagcttaagaaatcaagtcaacttgggacgaccgattatgttgctatgaaaaacgacgatgccgtaatgcaagggattatatcaatgctgactttcggttccagcgaccacgggtgggcgctgattgggaccggttcggcggagatgtctaaggcaaacggggagcatatgttaaggagcttgagggagtttaatgcgtggaagacaaggcacagtgagttagggtttacgcctgcactgaatgaataccttgctggggtgtctaagcaggccccacatcactgctccagtttgatgttgcctgtcaccggagtcatgccggagacggtggcctgcgctgaatgtggacgtatcatggagtggttcaacatgttccgctgctgcactgactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0008150 GO:0009888 GO:0010087 GO:0010088 GO:0032502 GO:0042802 GO:0042803 GO:0043621 GO:0046983 GO:0048856

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SEO_C SEO_N

Protein Analysis

360

Amino Acids

42.0

Weight (kDa)

6.81

Isoelectric Point (pI)

39.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002043)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g25290 FvH4_4g25290 FvH4_4g25290 FvH4_4g25310 FvH4_4g25320
malus_domestica	MD13G1105000.v1.1 MD13G1105100.v1.1 MD16G1104800.v1.1 MD16G1105000.v1.1
prunus_persica	Prupe.1G241400_v2.0.a1 Prupe.1G241500_v2.0.a1
pyrus_communis	pycom13g09110 pycom13g09120 pycom16g08950 pycom16g08960
rosa_chinensis	RchiOBHm_Chr4g0432561 RchiOBHm_Chr4g0432571 RchiOBHm_Chr4g0432611
rosa_laevigata	RLG00000006831 RLG00000006832 RLG00000006833
rosa_multiflora	Rmu_sc0003886.1_g000001 Rmu_sc0004612.1_g000014 Rmu_sc0027699.1_g000001
rosa_roxburghii	Rroxscaffold_5G00373990 Rroxscaffold_5G00374000 Rroxscaffold_5G00374030
rosa_rugosa	Rorug04G0260100 Rorug04G0260100 Rorug04G0260200
rosa_samantha	Rh4AG315100 Rh4AG315200 Rh4AG315300 Rh4BG322800 Rh4BG322900 Rh4BG323000 Rh4CG337900 Rh4CG338000 Rh4CG338100 Rh4DG318600 Rh4DG318700 Rh4DG318800
rosa_wichuraiana	Rw4G027380 Rw4G027390 Rw4G027420

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	468
AciI	CCGC	3 cut(s)	485, 830, 1066
AclWI	GGATC	3 cut(s)	422, 460, 473
AfaI	GTAC	7 cut(s)	20, 62, 110, 149, 194, 285, 443
AfiI	CCNNNNNNNGG	5 cut(s)	64, 205, 805, 946, 998
AflII	CTTAAG	1 cut(s)	695
AflIII	ACRYGT	1 cut(s)	1059
AgeI	ACCGGT	1 cut(s)	821
AgsI	TTSAA	4 cut(s)	325, 374, 590, 1057
AjnI	CCWGG	1 cut(s)	362
AjuI	GAANNNNNNNTTGG	2 cut(s)	484, 516
AluBI	AGCT	3 cut(s)	509, 694, 870
AluI	AGCT	3 cut(s)	509, 694, 870
Alw21I	GWGCWC	2 cut(s)	273, 348
Alw26I	GTCTC	2 cut(s)	353, 1007
Alw44I	GTGCAC	1 cut(s)	269
AlwI	GGATC	3 cut(s)	422, 460, 473
Aor13HI	TCCGGA	1 cut(s)	468
AoxI	GGCC	2 cut(s)	960, 1020
ApaLI	GTGCAC	1 cut(s)	269
ApeKI	GCWGC	2 cut(s)	1068, 1071
AsiGI	ACCGGT	1 cut(s)	821
AspLEI	GCGC	2 cut(s)	811, 1028
AspS9I	GGNCC	4 cut(s)	96, 250, 819, 961
AsuHPI	GGTGA	4 cut(s)	256, 409, 577, 988
AvaII	GGWCC	3 cut(s)	96, 250, 819
BaeGI	GKGCMC	1 cut(s)	273
BamHI	GGATCC	1 cut(s)	465
BbsI	GAAGAC	3 cut(s)	108, 459, 899
Bbv12I	GWGCWC	2 cut(s)	273, 348
BbvI	GCAGC	2 cut(s)	1055, 1058
BccI	CCATC	2 cut(s)	241, 398
BceAI	ACGGC	1 cut(s)	737
BcgI	CGANNNNNNTGC	2 cut(s)	713, 747
BciT130I	CCWGG	1 cut(s)	364
BclI	TGATCA	1 cut(s)	186
BcoDI	GTCTC	2 cut(s)	353, 1007
BfaI	CTAG	1 cut(s)	650
BfoI	RGCGCY	1 cut(s)	812
BfrI	CTTAAG	1 cut(s)	695
BisI	GCNGC	3 cut(s)	486, 1069, 1072
BlsI	GCNGC	3 cut(s)	487, 1070, 1073
Bme1390I	CCNGG	1 cut(s)	364
Bme18I	GGWCC	3 cut(s)	96, 250, 819
BmgT120I	GGNCC	4 cut(s)	96, 250, 819, 961
BmiI	GGNNCC	6 cut(s)	78, 252, 467, 790, 820, 963
BmrFI	CCNGG	1 cut(s)	364
BmsI	GCATC	1 cut(s)	739
BpiI	GAAGAC	3 cut(s)	108, 459, 899
BpmI	CTGGAG	3 cut(s)	385, 668, 961
BpuEI	CTTGAG	2 cut(s)	240, 892
Bsa29I	ATCGAT	1 cut(s)	393
BsaAI	YACGTR	2 cut(s)	22, 535
BsaI	GGTCTC	1 cut(s)	353
BsaJI	CCNNGG	1 cut(s)	799
BsaWI	WCCGGW	4 cut(s)	468, 516, 821, 998
BsaXI	ACNNNNNCTCC	6 cut(s)	44, 74, 666, 696, 845, 875
Bsc4I	CCNNNNNNNGG	5 cut(s)	64, 205, 805, 946, 998
Bse118I	RCCGGY	1 cut(s)	821
Bse1I	ACTGG	2 cut(s)	58, 978
BseAI	TCCGGA	1 cut(s)	468
BseBI	CCWGG	1 cut(s)	364
BseCI	ATCGAT	1 cut(s)	393
BseDI	CCNNGG	1 cut(s)	799
BseGI	GGATG	1 cut(s)	195
BseLI	CCNNNNNNNGG	5 cut(s)	64, 205, 805, 946, 998
BseNI	ACTGG	2 cut(s)	58, 978
BseRI	GAGGAG	1 cut(s)	371
BseSI	GKGCMC	1 cut(s)	273
BseXI	GCAGC	2 cut(s)	1055, 1058
BseYI	CCCAGC	1 cut(s)	944
BsgI	GTGCAG	2 cut(s)	909, 1057
Bsh1285I	CGRYCG	2 cut(s)	615, 723
BshFI	GGCC	2 cut(s)	962, 1022
BshTI	ACCGGT	1 cut(s)	821
BshVI	ATCGAT	1 cut(s)	393
BsiEI	CGRYCG	2 cut(s)	615, 723
BsiHKAI	GWGCWC	2 cut(s)	273, 348
BsiSI	CCGG	6 cut(s)	50, 469, 517, 822, 999, 1010
BslFI	GGGAC	2 cut(s)	730, 832
BslI	CCNNNNNNNGG	5 cut(s)	64, 205, 805, 946, 998
BsmAI	GTCTC	2 cut(s)	353, 1007
BsmBI	CGTCTC	1 cut(s)	1007
BsmFI	GGGAC	2 cut(s)	730, 832
BsnI	GGCC	2 cut(s)	962, 1022
Bso31I	GGTCTC	1 cut(s)	353
Bsp1286I	GDGCHC	2 cut(s)	273, 348
Bsp13I	TCCGGA	1 cut(s)	468
Bsp1407I	TGTACA	1 cut(s)	283
Bsp143I	GATC	5 cut(s)	3, 186, 414, 465, 612
BspACI	CCGC	3 cut(s)	485, 830, 1066
BspANI	GGCC	2 cut(s)	962, 1022
BspDI	ATCGAT	1 cut(s)	393
BspEI	TCCGGA	1 cut(s)	468
BspLI	GGNNCC	6 cut(s)	78, 252, 467, 790, 820, 963
BspPI	GGATC	3 cut(s)	422, 460, 473
BspTI	CTTAAG	1 cut(s)	695
BspTNI	GGTCTC	1 cut(s)	353
BsrFI	RCCGGY	1 cut(s)	821
BsrGI	TGTACA	1 cut(s)	283
BsrI	ACTGG	2 cut(s)	58, 978
BssAI	RCCGGY	1 cut(s)	821
BssECI	CCNNGG	1 cut(s)	799
BssMI	GATC	5 cut(s)	3, 186, 414, 465, 612
Bst2UI	CCWGG	1 cut(s)	364
Bst4CI	ACNGT	5 cut(s)	117, 184, 446, 905, 1018
Bst6I	CTCTTC	1 cut(s)	348
BstAFI	CTTAAG	1 cut(s)	695
BstAUI	TGTACA	1 cut(s)	283
BstBAI	YACGTR	2 cut(s)	22, 535
BstC8I	GCNNGC	3 cut(s)	924, 960, 1024
BstDEI	CTNAG	3 cut(s)	602, 840, 954
BstDSI	CCRYGG	1 cut(s)	799
BstF5I	GGATG	1 cut(s)	195
BstH2I	RGCGCY	1 cut(s)	812
BstHHI	GCGC	2 cut(s)	811, 1028
BstKTI	GATC	5 cut(s)	6, 189, 417, 468, 615
BstMAI	GTCTC	2 cut(s)	353, 1007
BstMBI	GATC	5 cut(s)	3, 186, 414, 465, 612
BstMCI	CGRYCG	2 cut(s)	615, 723
BstMWI	GCNNNNNNNGC	2 cut(s)	46, 506
BstNI	CCWGG	1 cut(s)	364
BstNSI	RCATGY	2 cut(s)	661, 1063
BstSCI	CCNGG	1 cut(s)	362
BstSLI	GKGCMC	1 cut(s)	273
BstV1I	GCAGC	2 cut(s)	1055, 1058
BstV2I	GAAGAC	3 cut(s)	108, 459, 899
BstX2I	RGATCY	1 cut(s)	465
BstYI	RGATCY	1 cut(s)	465
Bsu15I	ATCGAT	1 cut(s)	393
BsuRI	GGCC	2 cut(s)	962, 1022
BsuTUI	ATCGAT	1 cut(s)	393
BtgI	CCRYGG	1 cut(s)	799
BtsCI	GGATG	1 cut(s)	195
BtsI	GCAGTG	1 cut(s)	970
BtsIMutI	CAGTG	4 cut(s)	910, 926, 970, 1074
Cac8I	GCNNGC	3 cut(s)	924, 960, 1024
CfoI	GCGC	2 cut(s)	811, 1028
Cfr10I	RCCGGY	1 cut(s)	821
Cfr13I	GGNCC	4 cut(s)	96, 250, 819, 961
ClaI	ATCGAT	1 cut(s)	393
Csp6I	GTAC	7 cut(s)	19, 61, 109, 148, 193, 284, 442
CspAI	ACCGGT	1 cut(s)	821
CspCI	CAANNNNNGTGG	2 cut(s)	477, 512
CviAII	CATG	6 cut(s)	93, 289, 658, 1006, 1045, 1060
CviQI	GTAC	7 cut(s)	19, 61, 109, 148, 193, 284, 442
DdeI	CTNAG	3 cut(s)	602, 840, 954
DpnI	GATC	5 cut(s)	5, 188, 416, 467, 614
DpnII	GATC	5 cut(s)	3, 186, 414, 465, 612
Eam1104I	CTCTTC	1 cut(s)	348
EarI	CTCTTC	1 cut(s)	348
EciI	GGCGGA	1 cut(s)	845
Eco31I	GGTCTC	1 cut(s)	353
Eco47I	GGWCC	3 cut(s)	96, 250, 819
EcoO109I	RGGNCCY	1 cut(s)	961
EcoRII	CCWGG	1 cut(s)	362
Esp3I	CGTCTC	1 cut(s)	1007
FaeI	CATG	6 cut(s)	96, 292, 661, 1009, 1048, 1063
FalI	AAGNNNNNCTT	2 cut(s)	484, 516
FaqI	GGGAC	2 cut(s)	730, 832
FatI	CATG	6 cut(s)	92, 288, 657, 1005, 1044, 1059
FauNDI	CATATG	1 cut(s)	858
FbaI	TGATCA	1 cut(s)	186
Fnu4HI	GCNGC	3 cut(s)	486, 1069, 1072
FokI	GGATG	1 cut(s)	182
Fsp4HI	GCNGC	3 cut(s)	486, 1069, 1072
FspBI	CTAG	1 cut(s)	650
GlaI	GCGC	2 cut(s)	810, 1027
GluI	GCNGC	3 cut(s)	486, 1069, 1072
GsaI	CCCAGC	1 cut(s)	948
GsuI	CTGGAG	3 cut(s)	385, 668, 961
HaeII	RGCGCY	1 cut(s)	812
HaeIII	GGCC	2 cut(s)	962, 1022
HapII	CCGG	6 cut(s)	50, 469, 517, 822, 999, 1010
HhaI	GCGC	2 cut(s)	811, 1028
Hin1II	CATG	6 cut(s)	96, 292, 661, 1009, 1048, 1063
Hin6I	GCGC	2 cut(s)	809, 1026
HinP1I	GCGC	2 cut(s)	809, 1026
HincII	GTYRAC	1 cut(s)	710
HindII	GTYRAC	1 cut(s)	710
HindIII	AAGCTT	1 cut(s)	692
HinfI	GANTC	7 cut(s)	386, 513, 582, 598, 643, 665, 1002
HpaII	CCGG	6 cut(s)	50, 469, 517, 822, 999, 1010
HphI	GGTGA	4 cut(s)	256, 409, 577, 988
Hpy166II	GTNNAC	7 cut(s)	88, 157, 271, 286, 710, 918, 1037
Hpy188I	TCNGA	2 cut(s)	81, 200
Hpy188III	TCNNGA	6 cut(s)	121, 469, 590, 640, 650, 685
Hpy8I	GTNNAC	7 cut(s)	88, 157, 271, 286, 710, 918, 1037
Hpy99I	CGWCG	1 cut(s)	749
HpyAV	CCTTC	2 cut(s)	174, 541
HpyCH4III	ACNGT	5 cut(s)	117, 184, 446, 905, 1018
HpyCH4IV	ACGT	3 cut(s)	21, 534, 1039
HpyCH4V	TGCA	4 cut(s)	271, 760, 926, 1074
HpyF10VI	GCNNNNNNNGC	2 cut(s)	46, 506
HpyF3I	CTNAG	3 cut(s)	602, 840, 954
HpySE526I	ACGT	3 cut(s)	21, 534, 1039
Hsp92II	CATG	6 cut(s)	96, 292, 661, 1009, 1048, 1063
HspAI	GCGC	2 cut(s)	809, 1026
Kpn2I	TCCGGA	1 cut(s)	468
Ksp22I	TGATCA	1 cut(s)	186
Kzo9I	GATC	5 cut(s)	3, 186, 414, 465, 612
LmnI	GCTCC	3 cut(s)	853, 867, 980
Lsp1109I	GCAGC	2 cut(s)	1055, 1058
LweI	GCATC	1 cut(s)	739
MaeI	CTAG	1 cut(s)	650
MaeII	ACGT	3 cut(s)	21, 534, 1039
MaeIII	GTNAC	1 cut(s)	994
MalI	GATC	5 cut(s)	5, 188, 416, 467, 614
MboI	GATC	5 cut(s)	3, 186, 414, 465, 612
MboII	GAAGA	6 cut(s)	113, 238, 365, 464, 580, 904
MflI	RGATCY	1 cut(s)	465
MhlI	GDGCHC	2 cut(s)	273, 348
MluCI	AATT	5 cut(s)	133, 369, 405, 524, 623
MlyI	GAGTC	3 cut(s)	380, 637, 1011
MmeI	TCCRAC	2 cut(s)	34, 501
MnlI	CCTC	9 cut(s)	58, 117, 170, 199, 264, 331, 349, 537, 867
MroI	TCCGGA	1 cut(s)	468
MseI	TTAA	4 cut(s)	404, 696, 863, 882
MslI	CAYNNNNRTG	1 cut(s)	276
MspA1I	CMGCKG	1 cut(s)	1068
MspCI	CTTAAG	1 cut(s)	695
MspI	CCGG	6 cut(s)	50, 469, 517, 822, 999, 1010
MspR9I	CCNGG	1 cut(s)	364
MvaI	CCWGG	1 cut(s)	364
MwoI	GCNNNNNNNGC	2 cut(s)	46, 506
NdeI	CATATG	1 cut(s)	858
NdeII	GATC	5 cut(s)	3, 186, 414, 465, 612
NlaIII	CATG	6 cut(s)	96, 292, 661, 1009, 1048, 1063
NlaIV	GGNNCC	6 cut(s)	78, 252, 467, 790, 820, 963
NmuCI	GTSAC	1 cut(s)	994
NspI	RCATGY	2 cut(s)	661, 1063
PciI	ACATGT	1 cut(s)	1059
PcsI	WCGNNNNNNNCGW	3 cut(s)	117, 750, 792
PfeI	GAWTC	4 cut(s)	513, 582, 598, 665
PinAI	ACCGGT	1 cut(s)	821
PkrI	GCNGC	3 cut(s)	487, 1070, 1073
Ple19I	CGATCG	1 cut(s)	615
PleI	GAGTC	3 cut(s)	380, 637, 1010
PpsI	GAGTC	3 cut(s)	380, 637, 1010
Ppu21I	YACGTR	2 cut(s)	22, 535
PscI	ACATGT	1 cut(s)	1059
Psp6I	CCWGG	1 cut(s)	362
PspFI	CCCAGC	1 cut(s)	944
PspGI	CCWGG	1 cut(s)	362
PspN4I	GGNNCC	6 cut(s)	78, 252, 467, 790, 820, 963
PspPI	GGNCC	4 cut(s)	96, 250, 819, 961
PsrI	GAACNNNNNNTAC	2 cut(s)	101, 133
PsuI	RGATCY	1 cut(s)	465
PvuI	CGATCG	1 cut(s)	615
RsaI	GTAC	7 cut(s)	20, 62, 110, 149, 194, 285, 443
RsaNI	GTAC	7 cut(s)	19, 61, 109, 148, 193, 284, 442
RseI	CAYNNNNRTG	1 cut(s)	276
SaqAI	TTAA	4 cut(s)	404, 696, 863, 882
SatI	GCNGC	3 cut(s)	486, 1069, 1072
Sau3AI	GATC	5 cut(s)	3, 186, 414, 465, 612
Sau96I	GGNCC	4 cut(s)	96, 250, 819, 961
SchI	GAGTC	3 cut(s)	380, 637, 1011
ScrFI	CCNGG	1 cut(s)	364
SduI	GDGCHC	2 cut(s)	273, 348
SfaNI	GCATC	1 cut(s)	739
SinI	GGWCC	3 cut(s)	96, 250, 819
SmiMI	CAYNNNNRTG	1 cut(s)	276
SmlI	CTYRAG	3 cut(s)	255, 695, 871
SmoI	CTYRAG	3 cut(s)	255, 695, 871
Sse9I	AATT	5 cut(s)	133, 369, 405, 524, 623
SsiI	CCGC	3 cut(s)	485, 830, 1066
SspMI	CTAG	1 cut(s)	650
StyD4I	CCNGG	1 cut(s)	362
TaaI	ACNGT	5 cut(s)	117, 184, 446, 905, 1018
TaiI	ACGT	3 cut(s)	24, 537, 1042
TaqI	TCGA	3 cut(s)	120, 393, 615
TaqII	GACCGA	2 cut(s)	113, 737
TasI	AATT	5 cut(s)	133, 369, 405, 524, 623
TatI	WGTACW	1 cut(s)	283
TauI	GCSGC	1 cut(s)	488
TfiI	GAWTC	4 cut(s)	513, 582, 598, 665
Tru1I	TTAA	4 cut(s)	404, 696, 863, 882
Tru9I	TTAA	4 cut(s)	404, 696, 863, 882
TscAI	CASTG	4 cut(s)	910, 933, 977, 1081
TseFI	GTSAC	1 cut(s)	994
TseI	GCWGC	2 cut(s)	1068, 1071
Tsp45I	GTSAC	1 cut(s)	994
TspDTI	ATGAA	4 cut(s)	59, 616, 752, 948
TspGWI	ACGGA	2 cut(s)	157, 569
TspRI	CASTG	4 cut(s)	910, 933, 977, 1081
Vha464I	CTTAAG	1 cut(s)	695
VneI	GTGCAC	1 cut(s)	269
VpaK11BI	GGWCC	3 cut(s)	96, 250, 819
XbaI	TCTAGA	1 cut(s)	649
XceI	RCATGY	2 cut(s)	661, 1063
XspI	CTAG	1 cut(s)	650

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.