Rmu_sc0028648.1_g000003
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028648.1
Physical Location & Seq
Reverse (-)
25507 .. 26322
816 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028648.1_g000003.1.cds

Sequence Viewer

Length: 669 bp
atggaggccagtgctatctcaggtattatcacaacaattgaaacttctgtagctgagaaggaagataccatttcaaatgttactgaaggaaccgagcaacttaaaattgagaatctatcatcagatgctttgaatcccatagcacctacctctatcttggaaaaggacgagttattatcagatgatccgaagcatgcagaacattctttaaatgaagaaaaggagtatttactagcggatgatccaaagcatgtggaagatacttcaattgcagaaaaggatgtttctgtgaatggtgatggccctactgaggaagttaatcctagtgacgatagcagtagcaaatatgcattggctttagttgaagaagttaatgacatcgagaaggaaaacaataacttcccagacaatgaagcatggaaccaaacgccccagttgctagccagtcaggatataagccacagtgatagttgggaggttgcaaatgtcaacaacatcgcggaaccaaagaccccagttgccaatcaggttataaaacacaatgacagaggggaggttgcaaatgtcaacagcccttgggaaacgttgagtgcctgcagtactggtgtcaagcaatctcttgttcaagattatcttagcttcttaaacaccctagcaaagaagatttga

Protein Analysis

222

Amino Acids

24.24

Weight (kDa)

4.21

Isoelectric Point (pI)

40.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 533
AccII CGCG 1 cut(s) 500
AciI CCGC 2 cut(s) 236, 500
AclI AACGTT 1 cut(s) 584
AclWI GGATC 2 cut(s) 179, 236
AcuI CTGAAG 1 cut(s) 105
AfaI GTAC 1 cut(s) 601
AfiI CCNNNNNNNGG 1 cut(s) 310
AgsI TTSAA 6 cut(s) 41, 75, 133, 267, 365, 626
AluBI AGCT 2 cut(s) 53, 639
AluI AGCT 2 cut(s) 53, 639
AlwI GGATC 2 cut(s) 179, 236
AoxI GGCC 2 cut(s) 6, 301
AspS9I GGNCC 1 cut(s) 302
AsuHPI GGTGA 1 cut(s) 308
AsuNHI GCTAGC 1 cut(s) 439
BccI CCATC 1 cut(s) 293
BfaI CTAG 4 cut(s) 233, 324, 440, 653
BfmI CTRYAG 2 cut(s) 48, 595
BmcAI AGTACT 1 cut(s) 601
BmgT120I GGNCC 1 cut(s) 302
BmiI GGNNCC 3 cut(s) 91, 422, 504
BmrI ACTGGG 2 cut(s) 427, 509
BmsI GCATC 1 cut(s) 115
BmtI GCTAGC 1 cut(s) 443
BmuI ACTGGG 2 cut(s) 427, 509
BsaJI CCNNGG 1 cut(s) 575
Bsc4I CCNNNNNNNGG 1 cut(s) 310
Bse1I ACTGG 5 cut(s) 9, 433, 444, 515, 607
BseDI CCNNGG 1 cut(s) 575
BseGI GGATG 2 cut(s) 244, 286
BseLI CCNNNNNNNGG 1 cut(s) 310
BseMII CTCAG 3 cut(s) 33, 45, 300
BseNI ACTGG 5 cut(s) 9, 433, 444, 515, 607
Bsh1236I CGCG 1 cut(s) 500
BshFI GGCC 2 cut(s) 8, 303
BslI CCNNNNNNNGG 1 cut(s) 310
BsnI GGCC 2 cut(s) 8, 303
Bsp143I GATC 2 cut(s) 184, 241
BspACI CCGC 2 cut(s) 236, 500
BspANI GGCC 2 cut(s) 8, 303
BspCNI CTCAG 3 cut(s) 32, 46, 301
BspFNI CGCG 1 cut(s) 500
BspLI GGNNCC 3 cut(s) 91, 422, 504
BspMAI CTGCAG 1 cut(s) 599
BspOI GCTAGC 1 cut(s) 443
BspPI GGATC 2 cut(s) 179, 236
BsrI ACTGG 5 cut(s) 9, 433, 444, 515, 607
BssECI CCNNGG 1 cut(s) 575
BssMI GATC 2 cut(s) 184, 241
BssT1I CCWWGG 1 cut(s) 575
Bst4CI ACNGT 1 cut(s) 464
BstC8I GCNNGC 3 cut(s) 195, 441, 595
BstDEI CTNAG 4 cut(s) 19, 54, 309, 635
BstF5I GGATG 2 cut(s) 244, 286
BstFNI CGCG 1 cut(s) 500
BstKTI GATC 2 cut(s) 187, 244
BstMBI GATC 2 cut(s) 184, 241
BstMWI GCNNNNNNNGC 1 cut(s) 436
BstNSI RCATGY 2 cut(s) 197, 254
BstSFI CTRYAG 2 cut(s) 48, 595
BstUI CGCG 1 cut(s) 500
BsuRI GGCC 2 cut(s) 8, 303
BtgZI GCGATG 1 cut(s) 481
BtsCI GGATG 2 cut(s) 244, 286
BtsIMutI CAGTG 2 cut(s) 16, 469
Cac8I GCNNGC 3 cut(s) 195, 441, 595
Cfr13I GGNCC 1 cut(s) 302
Csp6I GTAC 1 cut(s) 600
CspCI CAANNNNNGTGG 2 cut(s) 234, 269
CviAII CATG 3 cut(s) 194, 251, 417
CviJI RGCY 8 cut(s) 8, 53, 303, 356, 443, 459, 573, 639
CviKI_1 RGCY 8 cut(s) 8, 53, 303, 356, 443, 459, 573, 639
CviQI GTAC 1 cut(s) 600
DdeI CTNAG 4 cut(s) 19, 54, 309, 635
DpnI GATC 2 cut(s) 186, 243
DpnII GATC 2 cut(s) 184, 241
DraI TTTAAA 1 cut(s) 210
Eco130I CCWWGG 1 cut(s) 575
Eco57I CTGAAG 1 cut(s) 105
EcoT14I CCWWGG 1 cut(s) 575
EcoT22I ATGCAT 1 cut(s) 352
ErhI CCWWGG 1 cut(s) 575
FaeI CATG 3 cut(s) 197, 254, 420
FaiI YATR 7 cut(s) 140, 195, 252, 348, 418, 455, 533
FalI AAGNNNNNCTT 2 cut(s) 618, 650
FatI CATG 3 cut(s) 193, 250, 416
FokI GGATG 2 cut(s) 251, 293
FspBI CTAG 4 cut(s) 233, 324, 440, 653
HaeIII GGCC 2 cut(s) 8, 303
Hin1II CATG 3 cut(s) 197, 254, 420
HincII GTYRAC 2 cut(s) 490, 568
HindII GTYRAC 2 cut(s) 490, 568
HinfI GANTC 2 cut(s) 112, 133
HphI GGTGA 1 cut(s) 308
Hpy166II GTNNAC 2 cut(s) 490, 568
Hpy188I TCNGA 3 cut(s) 124, 181, 189
Hpy188III TCNNGA 3 cut(s) 382, 449, 626
Hpy8I GTNNAC 2 cut(s) 490, 568
HpyAV CCTTC 3 cut(s) 52, 80, 379
HpyCH4III ACNGT 1 cut(s) 464
HpyCH4IV ACGT 1 cut(s) 584
HpyCH4V TGCA 6 cut(s) 197, 272, 350, 482, 560, 597
HpyF10VI GCNNNNNNNGC 1 cut(s) 436
HpyF3I CTNAG 4 cut(s) 19, 54, 309, 635
HpySE526I ACGT 1 cut(s) 584
Hsp92II CATG 3 cut(s) 197, 254, 420
Kzo9I GATC 2 cut(s) 184, 241
LweI GCATC 1 cut(s) 115
MaeI CTAG 4 cut(s) 233, 324, 440, 653
MaeII ACGT 1 cut(s) 584
MaeIII GTNAC 2 cut(s) 79, 326
MalI GATC 2 cut(s) 186, 243
MboI GATC 2 cut(s) 184, 241
MboII GAAGA 4 cut(s) 74, 227, 269, 377
MfeI CAATTG 2 cut(s) 36, 267
MluCI AATT 3 cut(s) 36, 105, 267
MnlI CCTC 5 cut(s) 160, 304, 469, 542, 547
Mph1103I ATGCAT 1 cut(s) 352
MseI TTAA 5 cut(s) 102, 209, 318, 372, 644
MunI CAATTG 2 cut(s) 36, 267
MvnI CGCG 1 cut(s) 500
MwoI GCNNNNNNNGC 1 cut(s) 436
NdeII GATC 2 cut(s) 184, 241
NheI GCTAGC 1 cut(s) 439
NlaIII CATG 3 cut(s) 197, 254, 420
NlaIV GGNNCC 3 cut(s) 91, 422, 504
NmuCI GTSAC 1 cut(s) 326
NsiI ATGCAT 1 cut(s) 352
NspI RCATGY 2 cut(s) 197, 254
PaeI GCATGC 1 cut(s) 197
PfeI GAWTC 2 cut(s) 112, 133
PsiI TTATAA 1 cut(s) 533
Psp1406I AACGTT 1 cut(s) 584
PspN4I GGNNCC 3 cut(s) 91, 422, 504
PspPI GGNCC 1 cut(s) 302
PstI CTGCAG 1 cut(s) 599
RsaI GTAC 1 cut(s) 601
RsaNI GTAC 1 cut(s) 600
SaqAI TTAA 5 cut(s) 102, 209, 318, 372, 644
Sau3AI GATC 2 cut(s) 184, 241
Sau96I GGNCC 1 cut(s) 302
ScaI AGTACT 1 cut(s) 601
SetI ASST 9 cut(s) 25, 55, 148, 152, 480, 531, 558, 587, 641
SfaNI GCATC 1 cut(s) 115
SfcI CTRYAG 2 cut(s) 48, 595
SphI GCATGC 1 cut(s) 197
Sse9I AATT 3 cut(s) 36, 105, 267
SsiI CCGC 2 cut(s) 236, 500
SspMI CTAG 4 cut(s) 233, 324, 440, 653
StyI CCWWGG 1 cut(s) 575
TaaI ACNGT 1 cut(s) 464
TaiI ACGT 1 cut(s) 587
TaqI TCGA 1 cut(s) 381
TasI AATT 3 cut(s) 36, 105, 267
TatI WGTACW 1 cut(s) 599
TfiI GAWTC 2 cut(s) 112, 133
Tru1I TTAA 5 cut(s) 102, 209, 318, 372, 644
Tru9I TTAA 5 cut(s) 102, 209, 318, 372, 644
TscAI CASTG 2 cut(s) 16, 469
TseFI GTSAC 1 cut(s) 326
Tsp45I GTSAC 1 cut(s) 326
TspDTI ATGAA 2 cut(s) 228, 426
TspRI CASTG 2 cut(s) 16, 469
XceI RCATGY 2 cut(s) 197, 254
XspI CTAG 4 cut(s) 233, 324, 440, 653
ZrmI AGTACT 1 cut(s) 601
Zsp2I ATGCAT 1 cut(s) 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.