Rh2DG449200
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
65122986 .. 65127987
5002 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG449200.1

Sequence Viewer

Length: 528 bp
ATGGAGGCAAGTGCTATCTCAGGTATTATCACAACAATTGAAACTTCTGTAGCTGAGAAGGAAGATACCATTTCAAATGTTACTGAAGGAACCGAGCAACTTAAAATTGAGAATCTATCATCAGATGCTTTGAATCCCATAGCACCTACCTCTATCTTGGAAAAGGACGAGTTATTATCAGATGATCCAAAGCATGCAGAACATTCTTTAAATGAAGAAAAGGAGTATTTACTAGCGGATGATCCAAAGCATGCGGAAGATACTTCAATTGCAGAAAAGGATGTTTCTGTGAATGGTGATGGCCCTACTGAGGAAGTTAATCCTAGTGACAATAGCAGTAGCAAATATGCATTGGCTTTAGTTGAAGAAGTTAATGACATCGAGAAGGAAAATAATAACTTCCCAGACAATGAAGATAAAAAAGTTCAAAATTCTCCCAAAAGAGCCCAAGAGATGTATCAAAGTGGCGTGCTAGCAACCATGAATGTGATGAGAATGGCAGAAGCACATGTGTGTATGGGGCGATGA

Protein Analysis

175

Amino Acids

19.18

Weight (kDa)

4.31

Isoelectric Point (pI)

42.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 236, 254
AclWI GGATC 2 cut(s) 179, 236
AcsI RAATTY 1 cut(s) 430
AcuI CTGAAG 1 cut(s) 105
AfiI CCNNNNNNNGG 1 cut(s) 310
AflIII ACRYGT 1 cut(s) 508
AgsI TTSAA 6 cut(s) 41, 75, 133, 267, 365, 428
AleI CACNNNNGTG 1 cut(s) 511
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
AlwI GGATC 2 cut(s) 179, 236
AoxI GGCC 1 cut(s) 301
ApoI RAATTY 1 cut(s) 430
AspS9I GGNCC 1 cut(s) 302
AsuHPI GGTGA 1 cut(s) 308
AsuNHI GCTAGC 1 cut(s) 472
BanII GRGCYC 1 cut(s) 448
BccI CCATC 1 cut(s) 293
BfaI CTAG 3 cut(s) 233, 324, 473
BfmI CTRYAG 1 cut(s) 48
BmgT120I GGNCC 1 cut(s) 302
BmiI GGNNCC 1 cut(s) 91
BmsI GCATC 1 cut(s) 115
BmtI GCTAGC 1 cut(s) 476
Bsc4I CCNNNNNNNGG 1 cut(s) 310
BseGI GGATG 2 cut(s) 244, 286
BseLI CCNNNNNNNGG 1 cut(s) 310
BseMII CTCAG 3 cut(s) 33, 45, 300
BshFI GGCC 1 cut(s) 303
BslI CCNNNNNNNGG 1 cut(s) 310
BsnI GGCC 1 cut(s) 303
Bsp1286I GDGCHC 1 cut(s) 448
Bsp143I GATC 2 cut(s) 184, 241
BspACI CCGC 2 cut(s) 236, 254
BspANI GGCC 1 cut(s) 303
BspCNI CTCAG 3 cut(s) 32, 46, 301
BspLI GGNNCC 1 cut(s) 91
BspOI GCTAGC 1 cut(s) 476
BspPI GGATC 2 cut(s) 179, 236
BssMI GATC 2 cut(s) 184, 241
BstC8I GCNNGC 4 cut(s) 195, 252, 470, 474
BstDEI CTNAG 3 cut(s) 19, 54, 309
BstF5I GGATG 2 cut(s) 244, 286
BstKTI GATC 2 cut(s) 187, 244
BstMBI GATC 2 cut(s) 184, 241
BstNSI RCATGY 3 cut(s) 197, 254, 512
BstSFI CTRYAG 1 cut(s) 48
BsuRI GGCC 1 cut(s) 303
BtsCI GGATG 2 cut(s) 244, 286
Cac8I GCNNGC 4 cut(s) 195, 252, 470, 474
Cfr13I GGNCC 1 cut(s) 302
CviAII CATG 4 cut(s) 194, 251, 481, 509
CviJI RGCY 4 cut(s) 53, 303, 356, 446
CviKI_1 RGCY 4 cut(s) 53, 303, 356, 446
DdeI CTNAG 3 cut(s) 19, 54, 309
DpnI GATC 2 cut(s) 186, 243
DpnII GATC 2 cut(s) 184, 241
DraI TTTAAA 1 cut(s) 210
Eco24I GRGCYC 1 cut(s) 448
Eco57I CTGAAG 1 cut(s) 105
EcoT22I ATGCAT 1 cut(s) 352
EcoT38I GRGCYC 1 cut(s) 448
FaeI CATG 4 cut(s) 197, 254, 484, 512
FaiI YATR 7 cut(s) 140, 195, 252, 348, 482, 510, 518
FatI CATG 4 cut(s) 193, 250, 480, 508
FokI GGATG 2 cut(s) 251, 293
FriOI GRGCYC 1 cut(s) 448
FspBI CTAG 3 cut(s) 233, 324, 473
HaeIII GGCC 1 cut(s) 303
Hin1II CATG 4 cut(s) 197, 254, 484, 512
HinfI GANTC 2 cut(s) 112, 133
HphI GGTGA 1 cut(s) 308
Hpy188I TCNGA 2 cut(s) 124, 181
Hpy188III TCNNGA 1 cut(s) 382
HpyAV CCTTC 3 cut(s) 52, 80, 379
HpyCH4V TGCA 3 cut(s) 197, 272, 350
HpyF3I CTNAG 3 cut(s) 19, 54, 309
Hsp92II CATG 4 cut(s) 197, 254, 484, 512
Kzo9I GATC 2 cut(s) 184, 241
LpnPI CCDG 2 cut(s) 6, 417
LweI GCATC 1 cut(s) 115
MaeI CTAG 3 cut(s) 233, 324, 473
MaeIII GTNAC 2 cut(s) 79, 326
MalI GATC 2 cut(s) 186, 243
MboI GATC 2 cut(s) 184, 241
MboII GAAGA 5 cut(s) 74, 227, 269, 377, 425
MfeI CAATTG 2 cut(s) 36, 267
MhlI GDGCHC 1 cut(s) 448
MluCI AATT 4 cut(s) 36, 105, 267, 430
MnlI CCTC 2 cut(s) 160, 304
Mph1103I ATGCAT 1 cut(s) 352
MseI TTAA 4 cut(s) 102, 209, 318, 372
MslI CAYNNNNRTG 2 cut(s) 485, 511
MunI CAATTG 2 cut(s) 36, 267
NdeII GATC 2 cut(s) 184, 241
NheI GCTAGC 1 cut(s) 472
NlaIII CATG 4 cut(s) 197, 254, 484, 512
NlaIV GGNNCC 1 cut(s) 91
NmuCI GTSAC 1 cut(s) 326
NsiI ATGCAT 1 cut(s) 352
NspI RCATGY 3 cut(s) 197, 254, 512
OliI CACNNNNGTG 1 cut(s) 511
PaeI GCATGC 2 cut(s) 197, 254
PciI ACATGT 1 cut(s) 508
PfeI GAWTC 2 cut(s) 112, 133
PscI ACATGT 1 cut(s) 508
PspN4I GGNNCC 1 cut(s) 91
PspPI GGNCC 1 cut(s) 302
RseI CAYNNNNRTG 2 cut(s) 485, 511
SaqAI TTAA 4 cut(s) 102, 209, 318, 372
Sau3AI GATC 2 cut(s) 184, 241
Sau96I GGNCC 1 cut(s) 302
SduI GDGCHC 1 cut(s) 448
SetI ASST 4 cut(s) 25, 55, 148, 152
SfaNI GCATC 1 cut(s) 115
SfcI CTRYAG 1 cut(s) 48
SmiMI CAYNNNNRTG 2 cut(s) 485, 511
SphI GCATGC 2 cut(s) 197, 254
Sse9I AATT 4 cut(s) 36, 105, 267, 430
SsiI CCGC 2 cut(s) 236, 254
SspMI CTAG 3 cut(s) 233, 324, 473
TaqI TCGA 1 cut(s) 381
TasI AATT 4 cut(s) 36, 105, 267, 430
TfiI GAWTC 2 cut(s) 112, 133
Tru1I TTAA 4 cut(s) 102, 209, 318, 372
Tru9I TTAA 4 cut(s) 102, 209, 318, 372
TseFI GTSAC 1 cut(s) 326
Tsp45I GTSAC 1 cut(s) 326
TspDTI ATGAA 3 cut(s) 228, 426, 497
XapI RAATTY 1 cut(s) 430
XceI RCATGY 3 cut(s) 197, 254, 512
XspI CTAG 3 cut(s) 233, 324, 473
Zsp2I ATGCAT 1 cut(s) 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.