Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0031066.1

Orthogroup ID

OG0001991

Physical Location & Seq

Genomic Coordinates Forward (+)

754 .. 1589

Gene Structure 836 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0031066.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 702 bp

atgtgttttcttggccagggatttatgggtcttagtggagcaatactggtccaattctatgacacactatgcaaaggcaaccccagcaacttcctcttattgctggccttgttgccaacactggtctccattttgttcatgccctttgtgagaatctatggagcttgtagagctgaaattgacaagaagtacttaaattacttctctgcttttgctctgctcattgctgcttatctcatggtcacaatcatactgagaaacatcttcacttttccattgtgggctagtgtcttcacattcacattacttcttctgattctactcgcctcacccattggaattgcaatcaaagctcaattcatggagttaaagagacagcgagaaacgagtacttctgctgctagttatgctttacttgggaaagaggcctctagagaatatgatcatgaagatatgaatcttgtgagtgctatgagctctgttaatttctggtttttgtttattgcaatgctttgtggaatgggtactggcttggccaccataaacaacatgagccaattaggccagtcacttggttacacaactgtagagataaacacctttgtttctctatggagtatatggaactttctaggcagatttggagctggtcattgtaggcatctgttatggttcacagtggtcactaatgcccaccattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MFS_1 Nodulin-like

Protein Analysis

233

Amino Acids

26.09

Weight (kDa)

8.62

Isoelectric Point (pI)

37.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001991)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G18940 AT1G74780 AT2G34350 AT2G34350 AT2G34355 AT2G34355
fragaria_vesca	FvH4_5g15790 FvH4_5g15790 FvH4_5g15790 FvH4_5g15810
malus_domestica	MD00G1132000.v1.1 MD06G1185400.v1.1 MD06G1185500.v1.1 MD06G1185600.v1.1 MD14G1191700.v1.1
prunus_persica	Prupe.5G184300_v2.0.a1 Prupe.5G184300_v2.0.a1
pyrus_communis	pycom06g16490 pycom06g16500 pycom14g15940
rosa_chinensis	RchiOBHm_Chr7g0180321 RchiOBHm_Chr7g0180331
rosa_laevigata	RLG00000005276 RLG00000005277
rosa_multiflora	Rmu_sc0003526.1_g000013 Rmu_sc0003526.1_g000014 Rmu_sc0031066.1_g000002 Rmu_ssc0000099.1_g000002 Rmu_ssc0000099.1_g000004
rosa_roxburghii	Rroxscaffold_3G00272980 Rroxscaffold_3G00272990
rosa_rugosa	Rorug06G0432000 Rorug06G0432100 Rorug06G0432200 Rorug06G0432300
rosa_samantha	Rh7AG032600 Rh7AG032700 Rh7BG032600 Rh7BG032700 Rh7CG034500 Rh7CG034600 Rh7DG033200 Rh7DG033300
rosa_wichuraiana	Rw7G002720 Rw7G002730

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	2 cut(s)	13, 534
AfaI	GTAC	3 cut(s)	191, 391, 526
AjnI	CCWGG	1 cut(s)	15
AluBI	AGCT	5 cut(s)	164, 173, 353, 477, 647
AluI	AGCT	5 cut(s)	164, 173, 353, 477, 647
Alw21I	GWGCWC	1 cut(s)	479
Alw26I	GTCTC	2 cut(s)	130, 367
AoxI	GGCC	5 cut(s)	13, 105, 426, 534, 562
ApeKI	GCWGC	2 cut(s)	227, 398
AspS9I	GGNCC	1 cut(s)	49
AsuHPI	GGTGA	1 cut(s)	321
AvaII	GGWCC	1 cut(s)	49
BalI	TGGCCA	2 cut(s)	15, 536
BanII	GRGCYC	1 cut(s)	479
BbsI	GAAGAC	1 cut(s)	283
Bbv12I	GWGCWC	1 cut(s)	479
BbvI	GCAGC	2 cut(s)	214, 385
BciT130I	CCWGG	1 cut(s)	17
BclI	TGATCA	1 cut(s)	442
BcoDI	GTCTC	2 cut(s)	130, 367
BfaI	CTAG	4 cut(s)	285, 402, 432, 632
BfmI	CTRYAG	1 cut(s)	585
BglI	GCCNNNNNGGC	1 cut(s)	561
BisI	GCNGC	2 cut(s)	228, 399
BlsI	GCNGC	2 cut(s)	229, 400
BmcAI	AGTACT	2 cut(s)	191, 391
Bme1390I	CCNGG	1 cut(s)	17
Bme18I	GGWCC	1 cut(s)	49
BmgT120I	GGNCC	1 cut(s)	49
BmrFI	CCNGG	1 cut(s)	17
BmsI	GCATC	1 cut(s)	670
BpiI	GAAGAC	1 cut(s)	283
BsaBI	GATNNNNATC	1 cut(s)	456
BsaI	GGTCTC	1 cut(s)	130
BsaJI	CCNNGG	1 cut(s)	16
Bse1I	ACTGG	4 cut(s)	51, 126, 532, 565
Bse3DI	GCAATG	2 cut(s)	222, 513
Bse8I	GATNNNNATC	1 cut(s)	456
BseBI	CCWGG	1 cut(s)	17
BseDI	CCNNGG	1 cut(s)	16
BseJI	GATNNNNATC	1 cut(s)	456
BseMI	GCAATG	2 cut(s)	222, 513
BseMII	CTCAG	1 cut(s)	245
BseNI	ACTGG	4 cut(s)	51, 126, 532, 565
BseXI	GCAGC	2 cut(s)	214, 385
BseYI	CCCAGC	1 cut(s)	83
BshFI	GGCC	5 cut(s)	15, 107, 428, 536, 564
BsiHKAI	GWGCWC	1 cut(s)	479
BsmAI	GTCTC	2 cut(s)	130, 367
BsnI	GGCC	5 cut(s)	15, 107, 428, 536, 564
Bso31I	GGTCTC	1 cut(s)	130
Bsp1286I	GDGCHC	1 cut(s)	479
Bsp143I	GATC	1 cut(s)	442
BspANI	GGCC	5 cut(s)	15, 107, 428, 536, 564
BspCNI	CTCAG	1 cut(s)	246
BspHI	TCATGA	1 cut(s)	445
BspTNI	GGTCTC	1 cut(s)	130
BsrDI	GCAATG	2 cut(s)	222, 513
BsrI	ACTGG	4 cut(s)	51, 126, 532, 565
BssECI	CCNNGG	1 cut(s)	16
BssMI	GATC	1 cut(s)	442
Bst2UI	CCWGG	1 cut(s)	17
Bst4CI	ACNGT	2 cut(s)	586, 679
BstC8I	GCNNGC	1 cut(s)	105
BstDEI	CTNAG	2 cut(s)	32, 254
BstKTI	GATC	1 cut(s)	445
BstMAI	GTCTC	2 cut(s)	130, 367
BstMBI	GATC	1 cut(s)	442
BstMWI	GCNNNNNNNGC	5 cut(s)	84, 170, 350, 407, 561
BstNI	CCWGG	1 cut(s)	17
BstSCI	CCNGG	1 cut(s)	15
BstSFI	CTRYAG	1 cut(s)	585
BstV1I	GCAGC	2 cut(s)	214, 385
BstV2I	GAAGAC	1 cut(s)	283
BstXI	CCANNNNNNTGG	1 cut(s)	572
BsuRI	GGCC	5 cut(s)	15, 107, 428, 536, 564
BtsIMutI	CAGTG	2 cut(s)	119, 684
Cac8I	GCNNGC	1 cut(s)	105
CciI	TCATGA	1 cut(s)	445
Cfr13I	GGNCC	1 cut(s)	49
Csp6I	GTAC	3 cut(s)	190, 390, 525
CviAII	CATG	5 cut(s)	139, 238, 361, 446, 550
CviQI	GTAC	3 cut(s)	190, 390, 525
DdeI	CTNAG	2 cut(s)	32, 254
DpnI	GATC	1 cut(s)	444
DpnII	GATC	1 cut(s)	442
EaeI	YGGCCR	2 cut(s)	13, 534
Ecl136II	GAGCTC	1 cut(s)	477
Eco147I	AGGCCT	1 cut(s)	428
Eco24I	GRGCYC	1 cut(s)	479
Eco31I	GGTCTC	1 cut(s)	130
Eco47I	GGWCC	1 cut(s)	49
Eco53kI	GAGCTC	1 cut(s)	477
EcoICRI	GAGCTC	1 cut(s)	477
EcoRII	CCWGG	1 cut(s)	15
EcoT38I	GRGCYC	1 cut(s)	479
FaeI	CATG	5 cut(s)	142, 241, 364, 449, 553
FalI	AAGNNNNNCTT	2 cut(s)	176, 208
FatI	CATG	5 cut(s)	138, 237, 360, 445, 549
FbaI	TGATCA	1 cut(s)	442
Fnu4HI	GCNGC	2 cut(s)	228, 399
FriOI	GRGCYC	1 cut(s)	479
Fsp4HI	GCNGC	2 cut(s)	228, 399
FspBI	CTAG	4 cut(s)	285, 402, 432, 632
GluI	GCNGC	2 cut(s)	228, 399
GsaI	CCCAGC	1 cut(s)	87
HaeIII	GGCC	5 cut(s)	15, 107, 428, 536, 564
Hin1II	CATG	5 cut(s)	142, 241, 364, 449, 553
HinfI	GANTC	3 cut(s)	153, 316, 457
HphI	GGTGA	1 cut(s)	321
Hpy166II	GTNNAC	1 cut(s)	675
Hpy188I	TCNGA	1 cut(s)	315
Hpy188III	TCNNGA	2 cut(s)	432, 446
Hpy8I	GTNNAC	1 cut(s)	675
HpyCH4III	ACNGT	2 cut(s)	586, 679
HpyCH4V	TGCA	3 cut(s)	72, 344, 506
HpyF10VI	GCNNNNNNNGC	5 cut(s)	84, 170, 350, 407, 561
HpyF3I	CTNAG	2 cut(s)	32, 254
Hsp92II	CATG	5 cut(s)	142, 241, 364, 449, 553
Ksp22I	TGATCA	1 cut(s)	442
Kzo9I	GATC	1 cut(s)	442
LmnI	GCTCC	3 cut(s)	38, 161, 644
Lsp1109I	GCAGC	2 cut(s)	214, 385
LweI	GCATC	1 cut(s)	670
MaeI	CTAG	4 cut(s)	285, 402, 432, 632
MaeIII	GTNAC	4 cut(s)	241, 567, 575, 682
MalI	GATC	1 cut(s)	444
MboI	GATC	1 cut(s)	442
MboII	GAAGA	4 cut(s)	256, 283, 302, 461
MhlI	GDGCHC	1 cut(s)	479
MlsI	TGGCCA	2 cut(s)	15, 536
MluCI	AATT	7 cut(s)	53, 177, 196, 339, 356, 484, 557
MluNI	TGGCCA	2 cut(s)	15, 536
MnlI	CCTC	4 cut(s)	104, 337, 418, 439
Mox20I	TGGCCA	2 cut(s)	15, 536
MscI	TGGCCA	2 cut(s)	15, 536
MseI	TTAA	3 cut(s)	194, 368, 483
Msp20I	TGGCCA	2 cut(s)	15, 536
MspR9I	CCNGG	1 cut(s)	17
MvaI	CCWGG	1 cut(s)	17
MwoI	GCNNNNNNNGC	5 cut(s)	84, 170, 350, 407, 561
NdeII	GATC	1 cut(s)	442
NlaIII	CATG	5 cut(s)	142, 241, 364, 449, 553
NmuCI	GTSAC	3 cut(s)	241, 567, 682
PagI	TCATGA	1 cut(s)	445
PceI	AGGCCT	1 cut(s)	428
PfeI	GAWTC	3 cut(s)	153, 316, 457
PkrI	GCNGC	2 cut(s)	229, 400
Psp124BI	GAGCTC	1 cut(s)	479
Psp6I	CCWGG	1 cut(s)	15
PspFI	CCCAGC	1 cut(s)	83
PspGI	CCWGG	1 cut(s)	15
PspPI	GGNCC	1 cut(s)	49
RsaI	GTAC	3 cut(s)	191, 391, 526
RsaNI	GTAC	3 cut(s)	190, 390, 525
SacI	GAGCTC	1 cut(s)	479
SaqAI	TTAA	3 cut(s)	194, 368, 483
SatI	GCNGC	2 cut(s)	228, 399
Sau3AI	GATC	1 cut(s)	442
Sau96I	GGNCC	1 cut(s)	49
ScaI	AGTACT	2 cut(s)	191, 391
ScrFI	CCNGG	1 cut(s)	17
SduI	GDGCHC	1 cut(s)	479
SetI	ASST	6 cut(s)	166, 175, 355, 479, 602, 649
SfaNI	GCATC	1 cut(s)	670
SfcI	CTRYAG	1 cut(s)	585
SinI	GGWCC	1 cut(s)	49
Sse9I	AATT	7 cut(s)	53, 177, 196, 339, 356, 484, 557
SseBI	AGGCCT	1 cut(s)	428
SspMI	CTAG	4 cut(s)	285, 402, 432, 632
SstI	GAGCTC	1 cut(s)	479
StuI	AGGCCT	1 cut(s)	428
StyD4I	CCNGG	1 cut(s)	15
TaaI	ACNGT	2 cut(s)	586, 679
TasI	AATT	7 cut(s)	53, 177, 196, 339, 356, 484, 557
TatI	WGTACW	2 cut(s)	189, 389
TfiI	GAWTC	3 cut(s)	153, 316, 457
Tru1I	TTAA	3 cut(s)	194, 368, 483
Tru9I	TTAA	3 cut(s)	194, 368, 483
TscAI	CASTG	2 cut(s)	126, 684
TseFI	GTSAC	3 cut(s)	241, 567, 682
TseI	GCWGC	2 cut(s)	227, 398
Tsp45I	GTSAC	3 cut(s)	241, 567, 682
TspDTI	ATGAA	4 cut(s)	127, 349, 462, 470
TspRI	CASTG	2 cut(s)	126, 684
VpaK11BI	GGWCC	1 cut(s)	49
XbaI	TCTAGA	1 cut(s)	431
XspI	CTAG	4 cut(s)	285, 402, 432, 632
ZrmI	AGTACT	2 cut(s)	191, 391

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.