Rmu_sc0032400.1_g000001

Conserved region of unknown function on GLTSCR protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032400.1
Physical Location & Seq
Forward (+)
1 .. 956
956 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032400.1_g000001.1.cds

Sequence Viewer

Length: 229 bp
gttactgccttaccatgtggtggcagattatgaggctgaagaggatgaccgaatccttgactctgacactacaggcatgatgccatctcgctctcagcagtgggatcacaacatttctgcaaaagttgctgagtttacagcaacgtttgagaaacaggcactggccttcaacattatctcccgcaagcgtgcttttggggaatttagatcagaagagacttatgattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.69

Weight (kDa)

4.63

Isoelectric Point (pI)

81.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 20
AciI CCGC 1 cut(s) 182
AclI AACGTT 1 cut(s) 144
AclWI GGATC 1 cut(s) 112
AcsI RAATTY 1 cut(s) 201
AcuI CTGAAG 1 cut(s) 58
AfiI CCNNNNNNNGG 1 cut(s) 20
AgsI TTSAA 1 cut(s) 170
Alw26I GTCTC 1 cut(s) 210
AlwI GGATC 1 cut(s) 112
AlwNI CAGNNNCTG 1 cut(s) 161
AoxI GGCC 1 cut(s) 163
ApoI RAATTY 1 cut(s) 201
BccI CCATC 1 cut(s) 92
BcoDI GTCTC 1 cut(s) 210
BfmI CTRYAG 1 cut(s) 70
BmsI GCATC 1 cut(s) 70
BsaXI ACNNNNNCTCC 2 cut(s) 162, 192
Bsc4I CCNNNNNNNGG 1 cut(s) 20
Bse1I ACTGG 1 cut(s) 166
BseGI GGATG 1 cut(s) 50
BseLI CCNNNNNNNGG 1 cut(s) 20
BseMII CTCAG 2 cut(s) 108, 121
BseNI ACTGG 1 cut(s) 166
BshFI GGCC 1 cut(s) 165
BslI CCNNNNNNNGG 1 cut(s) 20
BsmAI GTCTC 1 cut(s) 210
BsnI GGCC 1 cut(s) 165
Bsp143I GATC 2 cut(s) 104, 207
BspACI CCGC 1 cut(s) 182
BspANI GGCC 1 cut(s) 165
BspCNI CTCAG 2 cut(s) 107, 122
BspPI GGATC 1 cut(s) 112
BsrI ACTGG 1 cut(s) 166
BssMI GATC 2 cut(s) 104, 207
Bst6I CTCTTC 2 cut(s) 34, 208
BstAPI GCANNNNNTGC 1 cut(s) 126
BstC8I GCNNGC 2 cut(s) 186, 190
BstDEI CTNAG 2 cut(s) 94, 130
BstF5I GGATG 1 cut(s) 50
BstKTI GATC 2 cut(s) 107, 210
BstMAI GTCTC 1 cut(s) 210
BstMBI GATC 2 cut(s) 104, 207
BstMWI GCNNNNNNNGC 1 cut(s) 126
BstSFI CTRYAG 1 cut(s) 70
BsuRI GGCC 1 cut(s) 165
BtsCI GGATG 1 cut(s) 50
BtsI GCAGTG 1 cut(s) 105
BtsIMutI CAGTG 2 cut(s) 105, 159
Cac8I GCNNGC 2 cut(s) 186, 190
CaiI CAGNNNCTG 1 cut(s) 161
CviAII CATG 2 cut(s) 15, 77
CviJI RGCY 2 cut(s) 36, 165
CviKI_1 RGCY 2 cut(s) 36, 165
DdeI CTNAG 2 cut(s) 94, 130
DpnI GATC 2 cut(s) 106, 209
DpnII GATC 2 cut(s) 104, 207
Eam1104I CTCTTC 2 cut(s) 34, 208
EarI CTCTTC 2 cut(s) 34, 208
Eco57I CTGAAG 1 cut(s) 58
FaeI CATG 2 cut(s) 18, 80
FaiI YATR 4 cut(s) 16, 31, 78, 223
FatI CATG 2 cut(s) 14, 76
FauI CCCGC 1 cut(s) 189
FokI GGATG 1 cut(s) 57
HaeIII GGCC 1 cut(s) 165
Hin1II CATG 2 cut(s) 18, 80
HinfI GANTC 2 cut(s) 52, 60
Hpy166II GTNNAC 1 cut(s) 136
Hpy188I TCNGA 2 cut(s) 65, 212
Hpy8I GTNNAC 1 cut(s) 136
HpyAV CCTTC 1 cut(s) 176
HpyCH4IV ACGT 1 cut(s) 144
HpyCH4V TGCA 1 cut(s) 120
HpyF10VI GCNNNNNNNGC 1 cut(s) 126
HpyF3I CTNAG 2 cut(s) 94, 130
HpySE526I ACGT 1 cut(s) 144
Hsp92II CATG 2 cut(s) 18, 80
Kzo9I GATC 2 cut(s) 104, 207
LpnPI CCDG 3 cut(s) 58, 141, 147
LweI GCATC 1 cut(s) 70
MaeII ACGT 1 cut(s) 144
MalI GATC 2 cut(s) 106, 209
MboI GATC 2 cut(s) 104, 207
MboII GAAGA 2 cut(s) 51, 225
MluCI AATT 1 cut(s) 201
MlyI GAGTC 1 cut(s) 54
MnlI CCTC 2 cut(s) 26, 35
MwoI GCNNNNNNNGC 1 cut(s) 126
NdeII GATC 2 cut(s) 104, 207
NlaIII CATG 2 cut(s) 18, 80
PfeI GAWTC 1 cut(s) 52
PflMI CCANNNNNTGG 1 cut(s) 20
PleI GAGTC 1 cut(s) 54
PpsI GAGTC 1 cut(s) 54
Psp1406I AACGTT 1 cut(s) 144
PstNI CAGNNNCTG 1 cut(s) 161
Sau3AI GATC 2 cut(s) 104, 207
SchI GAGTC 1 cut(s) 54
SetI ASST 1 cut(s) 147
SfaNI GCATC 1 cut(s) 70
SfcI CTRYAG 1 cut(s) 70
Sse9I AATT 1 cut(s) 201
SsiI CCGC 1 cut(s) 182
TaiI ACGT 1 cut(s) 147
TaqII GACCGA 1 cut(s) 64
TasI AATT 1 cut(s) 201
TfiI GAWTC 1 cut(s) 52
TscAI CASTG 2 cut(s) 105, 166
TspRI CASTG 2 cut(s) 105, 166
Van91I CCANNNNNTGG 1 cut(s) 20
XapI RAATTY 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.