Rmu_sc0034891.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0034891.1
Physical Location & Seq
Forward (+)
1 .. 540
540 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0034891.1_g000001.1.cds

Sequence Viewer

Length: 210 bp
ttaacaaacaacttggcgaaacccaatgccagagatgcagagagagcacacttccagccaaagtcaaaggagcaaaaggaggcagagataaaaaagctaagacagagtcttaagttcaaggctacaccaacgcctgattcttatcggggacaaaagttatcgaaaagtactctagaaaaggagggtcctaagaaagaaacgcttcggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.92

Weight (kDa)

10.12

Isoelectric Point (pI)

17.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 169
AflII CTTAAG 1 cut(s) 110
AgsI TTSAA 1 cut(s) 118
AjuI GAANNNNNNNTTGG 2 cut(s) 121, 153
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
Alw21I GWGCWC 1 cut(s) 49
Asp700I GAANNNNTTC 1 cut(s) 201
AspS9I GGNCC 1 cut(s) 185
AvaII GGWCC 1 cut(s) 185
Bbv12I GWGCWC 1 cut(s) 49
BfaI CTAG 1 cut(s) 173
BfrI CTTAAG 1 cut(s) 110
BmcAI AGTACT 1 cut(s) 169
Bme18I GGWCC 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 185
BmiI GGNNCC 1 cut(s) 186
BmsI GCATC 1 cut(s) 25
BsaBI GATNNNNATC 1 cut(s) 141
Bse8I GATNNNNATC 1 cut(s) 141
BseJI GATNNNNATC 1 cut(s) 141
BsiHKAI GWGCWC 1 cut(s) 49
BslFI GGGAC 1 cut(s) 162
BsmFI GGGAC 1 cut(s) 162
Bsp1286I GDGCHC 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 186
BspTI CTTAAG 1 cut(s) 110
BstAFI CTTAAG 1 cut(s) 110
BstDEI CTNAG 2 cut(s) 98, 189
BstMWI GCNNNNNNNGC 2 cut(s) 35, 44
Cfr13I GGNCC 1 cut(s) 185
Csp6I GTAC 1 cut(s) 168
CviJI RGCY 3 cut(s) 58, 97, 122
CviKI_1 RGCY 3 cut(s) 58, 97, 122
CviQI GTAC 1 cut(s) 168
DdeI CTNAG 2 cut(s) 98, 189
Eco47I GGWCC 1 cut(s) 185
EcoO109I RGGNCCY 1 cut(s) 185
FalI AAGNNNNNCTT 1 cut(s) 186
FaqI GGGAC 1 cut(s) 162
FspBI CTAG 1 cut(s) 173
HinfI GANTC 2 cut(s) 106, 137
Hpy188III TCNNGA 1 cut(s) 173
HpyCH4V TGCA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 2 cut(s) 35, 44
HpyF3I CTNAG 2 cut(s) 98, 189
LmnI GCTCC 1 cut(s) 70
LpnPI CCDG 3 cut(s) 43, 68, 147
LweI GCATC 1 cut(s) 25
MaeI CTAG 1 cut(s) 173
MhlI GDGCHC 1 cut(s) 49
MlyI GAGTC 1 cut(s) 115
MnlI CCTC 2 cut(s) 73, 175
MroXI GAANNNNTTC 1 cut(s) 201
MseI TTAA 2 cut(s) 2, 111
MspCI CTTAAG 1 cut(s) 110
MwoI GCNNNNNNNGC 2 cut(s) 35, 44
NlaIV GGNNCC 1 cut(s) 186
PdmI GAANNNNTTC 1 cut(s) 201
PfeI GAWTC 1 cut(s) 137
PflFI GACNNNGTC 1 cut(s) 105
PleI GAGTC 1 cut(s) 114
PpsI GAGTC 1 cut(s) 114
PpuMI RGGWCCY 1 cut(s) 185
Psp5II RGGWCCY 1 cut(s) 185
PspN4I GGNNCC 1 cut(s) 186
PspPI GGNCC 1 cut(s) 185
PspPPI RGGWCCY 1 cut(s) 185
PsyI GACNNNGTC 1 cut(s) 105
RsaI GTAC 1 cut(s) 169
RsaNI GTAC 1 cut(s) 168
SaqAI TTAA 2 cut(s) 2, 111
Sau96I GGNCC 1 cut(s) 185
ScaI AGTACT 1 cut(s) 169
SchI GAGTC 1 cut(s) 115
SduI GDGCHC 1 cut(s) 49
SetI ASST 1 cut(s) 99
SfaNI GCATC 1 cut(s) 25
SgeI CNNG 7 cut(s) 25, 42, 67, 130, 146, 158, 185
SinI GGWCC 1 cut(s) 185
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
SspMI CTAG 1 cut(s) 173
TaqI TCGA 1 cut(s) 161
TatI WGTACW 1 cut(s) 167
TfiI GAWTC 1 cut(s) 137
Tru1I TTAA 2 cut(s) 2, 111
Tru9I TTAA 2 cut(s) 2, 111
Tth111I GACNNNGTC 1 cut(s) 105
Vha464I CTTAAG 1 cut(s) 110
VpaK11BI GGWCC 1 cut(s) 185
XbaI TCTAGA 1 cut(s) 172
XmnI GAANNNNTTC 1 cut(s) 201
XspI CTAG 1 cut(s) 173
ZrmI AGTACT 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.