Rmu_sc0035249.1_g000001

Nuclear fragile X mental retardation-interacting protein 1 (NUFIP1)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0035249.1
Physical Location & Seq
Forward (+)
193 .. 789
597 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0035249.1_g000001.1.cds

Sequence Viewer

Length: 597 bp
atgggacctcagcccggtttcatgaatttatctaacaatcttcttccgatgcaaaataaccatatgcgtgtgcccatgtcgcaatttggtacccttggtccgatatctcaaccaggttatcccagtgttggattttgtggtccacagaataatgcactcaatatgaacttggctgcttcctatccatttaacgggcagttatgcaatatggggcagaatctcaatcaagtaaatcaaaatatgggttttctacctggtcaattgtttggacataacctgttgaatttacagctgatgaatcaaaatattgggccatatgggcaattctgttcgccgaatctgttgaataggaatcaggttgtgccagtgcaaatgcaaatgcaaaacgcttgccaaggtggtcctaattatgcatttggggggtcaaatcaagcacctcaggctgcagttctgcaaaatcctgctttttttgcaactcccaattctggtaatgtgcactctccaaatcaggccggacaacaaatcaaccagaatcagcaaaacaacgtcttccgagggacacaggtaccttcatttttccttgtggatatctgctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

198

Amino Acids

21.47

Weight (kDa)

8.38

Isoelectric Point (pI)

36.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 2 cut(s) 89, 565
AccB1I GGYRCC 2 cut(s) 89, 565
AcsI RAATTY 2 cut(s) 25, 283
AfaI GTAC 2 cut(s) 91, 567
AfiI CCNNNNNNNGG 4 cut(s) 14, 128, 191, 485
AgsI TTSAA 2 cut(s) 283, 346
AjnI CCWGG 2 cut(s) 112, 253
AluBI AGCT 1 cut(s) 292
AluI AGCT 1 cut(s) 292
Alw21I GWGCWC 1 cut(s) 498
Alw44I GTGCAC 1 cut(s) 494
AoxI GGCC 2 cut(s) 311, 510
ApaLI GTGCAC 1 cut(s) 494
ApeKI GCWGC 2 cut(s) 173, 443
ApoI RAATTY 2 cut(s) 25, 283
Asp718I GGTACC 2 cut(s) 89, 565
AspS9I GGNCC 5 cut(s) 5, 98, 140, 311, 401
AsuC2I CCSGG 1 cut(s) 15
AvaII GGWCC 4 cut(s) 5, 98, 140, 401
AxyI CCTNAGG 1 cut(s) 438
BaeGI GKGCMC 2 cut(s) 75, 498
BaeI ACNNNNGTAYC 2 cut(s) 549, 582
BanI GGYRCC 2 cut(s) 89, 565
BbsI GAAGAC 1 cut(s) 541
Bbv12I GWGCWC 1 cut(s) 498
BbvCI CCTCAGC 1 cut(s) 9
BbvI GCAGC 2 cut(s) 160, 430
BciT130I CCWGG 2 cut(s) 114, 255
BcnI CCSGG 1 cut(s) 15
BfmI CTRYAG 1 cut(s) 444
BglI GCCNNNNNGGC 1 cut(s) 319
BisI GCNGC 2 cut(s) 174, 444
BlsI GCNGC 2 cut(s) 175, 445
Bme1390I CCNGG 3 cut(s) 15, 114, 255
Bme18I GGWCC 4 cut(s) 5, 98, 140, 401
BmgT120I GGNCC 5 cut(s) 5, 98, 140, 311, 401
BmiI GGNNCC 3 cut(s) 6, 91, 567
BmrFI CCNGG 3 cut(s) 15, 114, 255
BmrI ACTGGG 1 cut(s) 117
BmsI GCATC 1 cut(s) 39
BmuI ACTGGG 1 cut(s) 117
BpiI GAAGAC 1 cut(s) 541
Bpu10I CCTNAGC 1 cut(s) 9
BpuMI CCSGG 1 cut(s) 15
BsaJI CCNNGG 3 cut(s) 94, 394, 553
Bsc4I CCNNNNNNNGG 4 cut(s) 14, 128, 191, 485
Bse1I ACTGG 2 cut(s) 123, 365
Bse21I CCTNAGG 1 cut(s) 438
BseBI CCWGG 2 cut(s) 114, 255
BseDI CCNNGG 3 cut(s) 94, 394, 553
BseLI CCNNNNNNNGG 4 cut(s) 14, 128, 191, 485
BseMII CTCAG 2 cut(s) 23, 452
BseNI ACTGG 2 cut(s) 123, 365
BseSI GKGCMC 2 cut(s) 75, 498
BseXI GCAGC 2 cut(s) 160, 430
BshFI GGCC 2 cut(s) 313, 512
BshNI GGYRCC 2 cut(s) 89, 565
BsiHKAI GWGCWC 1 cut(s) 498
BsiSI CCGG 2 cut(s) 15, 513
BslFI GGGAC 2 cut(s) 18, 571
BslI CCNNNNNNNGG 4 cut(s) 14, 128, 191, 485
BsmFI GGGAC 2 cut(s) 18, 571
BsnI GGCC 2 cut(s) 313, 512
Bsp1286I GDGCHC 2 cut(s) 75, 498
BspANI GGCC 2 cut(s) 313, 512
BspCNI CTCAG 2 cut(s) 22, 451
BspHI TCATGA 1 cut(s) 21
BspLI GGNNCC 3 cut(s) 6, 91, 567
BspMAI CTGCAG 1 cut(s) 448
BspT107I GGYRCC 2 cut(s) 89, 565
BsrI ACTGG 2 cut(s) 123, 365
BssECI CCNNGG 3 cut(s) 94, 394, 553
BssT1I CCWWGG 2 cut(s) 94, 394
Bst2UI CCWGG 2 cut(s) 114, 255
BstC8I GCNNGC 1 cut(s) 391
BstDEI CTNAG 2 cut(s) 9, 438
BstMWI GCNNNNNNNGC 4 cut(s) 79, 319, 440, 470
BstNI CCWGG 2 cut(s) 114, 255
BstSCI CCNGG 3 cut(s) 13, 112, 253
BstSFI CTRYAG 1 cut(s) 444
BstSLI GKGCMC 2 cut(s) 75, 498
BstV1I GCAGC 2 cut(s) 160, 430
BstV2I GAAGAC 1 cut(s) 541
Bsu36I CCTNAGG 1 cut(s) 438
BsuRI GGCC 2 cut(s) 313, 512
BtsIMutI CAGTG 2 cut(s) 130, 372
Cac8I GCNNGC 1 cut(s) 391
CciI TCATGA 1 cut(s) 21
Cfr13I GGNCC 5 cut(s) 5, 98, 140, 311, 401
CsiI ACCWGGT 2 cut(s) 112, 253
Csp6I GTAC 2 cut(s) 90, 566
CviAII CATG 2 cut(s) 22, 76
CviJI RGCY 6 cut(s) 13, 173, 292, 313, 443, 512
CviKI_1 RGCY 6 cut(s) 13, 173, 292, 313, 443, 512
CviQI GTAC 2 cut(s) 90, 566
DdeI CTNAG 2 cut(s) 9, 438
Eco130I CCWWGG 2 cut(s) 94, 394
Eco32I GATATC 2 cut(s) 105, 589
Eco47I GGWCC 4 cut(s) 5, 98, 140, 401
Eco81I CCTNAGG 1 cut(s) 438
EcoO109I RGGNCCY 1 cut(s) 5
EcoRII CCWGG 2 cut(s) 112, 253
EcoRV GATATC 2 cut(s) 105, 589
EcoT14I CCWWGG 2 cut(s) 94, 394
EcoT22I ATGCAT 1 cut(s) 415
ErhI CCWWGG 2 cut(s) 94, 394
FaeI CATG 2 cut(s) 25, 79
FaqI GGGAC 2 cut(s) 18, 571
FatI CATG 2 cut(s) 21, 75
FauNDI CATATG 2 cut(s) 63, 316
Fnu4HI GCNGC 2 cut(s) 174, 444
Fsp4HI GCNGC 2 cut(s) 174, 444
GluI GCNGC 2 cut(s) 174, 444
HaeIII GGCC 2 cut(s) 313, 512
HapII CCGG 2 cut(s) 15, 513
Hin1II CATG 2 cut(s) 25, 79
HinfI GANTC 5 cut(s) 217, 298, 337, 352, 532
HpaII CCGG 2 cut(s) 15, 513
Hpy166II GTNNAC 2 cut(s) 143, 496
Hpy188I TCNGA 3 cut(s) 48, 102, 554
Hpy188III TCNNGA 1 cut(s) 22
Hpy8I GTNNAC 2 cut(s) 143, 496
HpyAV CCTTC 1 cut(s) 579
HpyCH4IV ACGT 1 cut(s) 546
HpyF10VI GCNNNNNNNGC 4 cut(s) 79, 319, 440, 470
HpyF3I CTNAG 2 cut(s) 9, 438
HpySE526I ACGT 1 cut(s) 546
Hsp92II CATG 2 cut(s) 25, 79
KpnI GGTACC 2 cut(s) 93, 569
Lsp1109I GCAGC 2 cut(s) 160, 430
LweI GCATC 1 cut(s) 39
MabI ACCWGGT 2 cut(s) 112, 253
MaeII ACGT 1 cut(s) 546
MboII GAAGA 3 cut(s) 32, 35, 541
MfeI CAATTG 1 cut(s) 260
MhlI GDGCHC 2 cut(s) 75, 498
MluCI AATT 7 cut(s) 25, 83, 260, 283, 323, 406, 481
MmeI TCCRAC 1 cut(s) 109
MnlI CCTC 3 cut(s) 18, 447, 548
Mph1103I ATGCAT 1 cut(s) 415
MseI TTAA 1 cut(s) 189
MslI CAYNNNNRTG 1 cut(s) 66
MspA1I CMGCKG 1 cut(s) 292
MspI CCGG 2 cut(s) 15, 513
MspR9I CCNGG 3 cut(s) 15, 114, 255
MunI CAATTG 1 cut(s) 260
MvaI CCWGG 2 cut(s) 114, 255
MwoI GCNNNNNNNGC 4 cut(s) 79, 319, 440, 470
NciI CCSGG 1 cut(s) 15
NdeI CATATG 2 cut(s) 63, 316
NlaIII CATG 2 cut(s) 25, 79
NlaIV GGNNCC 3 cut(s) 6, 91, 567
NsiI ATGCAT 1 cut(s) 415
PagI TCATGA 1 cut(s) 21
PfeI GAWTC 5 cut(s) 217, 298, 337, 352, 532
PkrI GCNGC 2 cut(s) 175, 445
PpuMI RGGWCCY 1 cut(s) 5
Psp5II RGGWCCY 1 cut(s) 5
Psp6I CCWGG 2 cut(s) 112, 253
PspGI CCWGG 2 cut(s) 112, 253
PspN4I GGNNCC 3 cut(s) 6, 91, 567
PspPI GGNCC 5 cut(s) 5, 98, 140, 311, 401
PspPPI RGGWCCY 1 cut(s) 5
PstI CTGCAG 1 cut(s) 448
PvuII CAGCTG 1 cut(s) 292
RsaI GTAC 2 cut(s) 91, 567
RsaNI GTAC 2 cut(s) 90, 566
RseI CAYNNNNRTG 1 cut(s) 66
SaqAI TTAA 1 cut(s) 189
SatI GCNGC 2 cut(s) 174, 444
Sau96I GGNCC 5 cut(s) 5, 98, 140, 311, 401
ScrFI CCNGG 3 cut(s) 15, 114, 255
SduI GDGCHC 2 cut(s) 75, 498
SexAI ACCWGGT 2 cut(s) 112, 253
SfaNI GCATC 1 cut(s) 39
SfcI CTRYAG 1 cut(s) 444
SinI GGWCC 4 cut(s) 5, 98, 140, 401
SmiMI CAYNNNNRTG 1 cut(s) 66
Sse9I AATT 7 cut(s) 25, 83, 260, 283, 323, 406, 481
SspI AATATT 1 cut(s) 307
StyD4I CCNGG 3 cut(s) 13, 112, 253
StyI CCWWGG 2 cut(s) 94, 394
TaiI ACGT 1 cut(s) 549
TasI AATT 7 cut(s) 25, 83, 260, 283, 323, 406, 481
TfiI GAWTC 5 cut(s) 217, 298, 337, 352, 532
Tru1I TTAA 1 cut(s) 189
Tru9I TTAA 1 cut(s) 189
TscAI CASTG 2 cut(s) 130, 372
TseI GCWGC 2 cut(s) 173, 443
TspDTI ATGAA 5 cut(s) 10, 38, 179, 311, 561
TspRI CASTG 2 cut(s) 130, 372
VneI GTGCAC 1 cut(s) 494
VpaK11BI GGWCC 4 cut(s) 5, 98, 140, 401
XapI RAATTY 2 cut(s) 25, 283
Zsp2I ATGCAT 1 cut(s) 415
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.