Rmu_sc0036906.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0036906.1
Physical Location & Seq
Forward (+)
1 .. 325
325 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0036906.1_g000001.1.cds

Sequence Viewer

Length: 165 bp
accctcgacactaactacaccaccagcagcggtggcaattcccctattgccaactggcccatttccagtcccggggaccatccgcaggaggtcaaggctcgcctcaaggcctgggcgcaggcagtggctctggcatctgcatcacccacaaggcactcgagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

5.63

Weight (kDa)

8.22

Isoelectric Point (pI)

41.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010914)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 30, 83
AfiI CCNNNNNNNGG 2 cut(s) 72, 85
AjnI CCWGG 1 cut(s) 110
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
Ama87I CYCGRG 2 cut(s) 71, 157
AoxI GGCC 2 cut(s) 56, 108
ApeKI GCWGC 1 cut(s) 27
AspLEI GCGC 1 cut(s) 118
AspS9I GGNCC 2 cut(s) 57, 76
AsuC2I CCSGG 2 cut(s) 72, 73
AsuHPI GGTGA 1 cut(s) 135
AvaI CYCGRG 2 cut(s) 71, 157
AvaII GGWCC 1 cut(s) 76
BbvI GCAGC 1 cut(s) 39
BccI CCATC 1 cut(s) 87
BciT130I CCWGG 1 cut(s) 112
BcnI CCSGG 2 cut(s) 72, 73
BisI GCNGC 1 cut(s) 28
BlsI GCNGC 1 cut(s) 29
Bme1390I CCNGG 3 cut(s) 72, 73, 112
Bme18I GGWCC 1 cut(s) 76
BmeT110I CYCGRG 2 cut(s) 71, 157
BmgT120I GGNCC 2 cut(s) 57, 76
BmiI GGNNCC 1 cut(s) 77
BmrFI CCNGG 3 cut(s) 72, 73, 112
BmsI GCATC 2 cut(s) 143, 149
BpuEI CTTGAG 1 cut(s) 89
BpuMI CCSGG 2 cut(s) 72, 73
BsaJI CCNNGG 3 cut(s) 71, 72, 111
Bsc4I CCNNNNNNNGG 2 cut(s) 72, 85
Bse1I ACTGG 2 cut(s) 59, 66
BseBI CCWGG 1 cut(s) 112
BseDI CCNNGG 3 cut(s) 71, 72, 111
BseGI GGATG 1 cut(s) 79
BseLI CCNNNNNNNGG 2 cut(s) 72, 85
BseNI ACTGG 2 cut(s) 59, 66
BseXI GCAGC 1 cut(s) 39
BshFI GGCC 2 cut(s) 58, 110
BsiHKCI CYCGRG 2 cut(s) 71, 157
BsiSI CCGG 1 cut(s) 72
BslFI GGGAC 2 cut(s) 54, 89
BslI CCNNNNNNNGG 2 cut(s) 72, 85
BsmFI GGGAC 2 cut(s) 54, 89
BsnI GGCC 2 cut(s) 58, 110
BsoBI CYCGRG 2 cut(s) 71, 157
BspACI CCGC 2 cut(s) 30, 83
BspANI GGCC 2 cut(s) 58, 110
BspLI GGNNCC 1 cut(s) 77
BsrI ACTGG 2 cut(s) 59, 66
BssECI CCNNGG 3 cut(s) 71, 72, 111
Bst2UI CCWGG 1 cut(s) 112
BstC8I GCNNGC 2 cut(s) 100, 120
BstF5I GGATG 1 cut(s) 79
BstHHI GCGC 1 cut(s) 118
BstMWI GCNNNNNNNGC 1 cut(s) 33
BstNI CCWGG 1 cut(s) 112
BstSCI CCNGG 3 cut(s) 70, 71, 110
BstV1I GCAGC 1 cut(s) 39
BsuRI GGCC 2 cut(s) 58, 110
BtsCI GGATG 1 cut(s) 79
BtsI GCAGTG 1 cut(s) 129
BtsIMutI CAGTG 1 cut(s) 129
Cac8I GCNNGC 2 cut(s) 100, 120
CfoI GCGC 1 cut(s) 118
Cfr13I GGNCC 2 cut(s) 57, 76
Cfr9I CCCGGG 1 cut(s) 71
CviJI RGCY 5 cut(s) 58, 98, 110, 128, 162
CviKI_1 RGCY 5 cut(s) 58, 98, 110, 128, 162
Eco147I AGGCCT 1 cut(s) 110
Eco47I GGWCC 1 cut(s) 76
Eco88I CYCGRG 2 cut(s) 71, 157
EcoRII CCWGG 1 cut(s) 110
FaqI GGGAC 2 cut(s) 54, 89
Fnu4HI GCNGC 1 cut(s) 28
FokI GGATG 1 cut(s) 66
Fsp4HI GCNGC 1 cut(s) 28
GlaI GCGC 1 cut(s) 117
GluI GCNGC 1 cut(s) 28
HaeIII GGCC 2 cut(s) 58, 110
HapII CCGG 1 cut(s) 72
HhaI GCGC 1 cut(s) 118
Hin6I GCGC 1 cut(s) 116
HinP1I GCGC 1 cut(s) 116
HpaII CCGG 1 cut(s) 72
HphI GGTGA 1 cut(s) 135
HpyCH4V TGCA 1 cut(s) 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 33
HspAI GCGC 1 cut(s) 116
LpnPI CCDG 9 cut(s) 37, 40, 71, 79, 85, 97, 104, 116, 124
Lsp1109I GCAGC 1 cut(s) 39
LweI GCATC 2 cut(s) 143, 149
MluCI AATT 1 cut(s) 37
MnlI CCTC 3 cut(s) 14, 82, 113
MspA1I CMGCKG 1 cut(s) 30
MspI CCGG 1 cut(s) 72
MspR9I CCNGG 3 cut(s) 72, 73, 112
MvaI CCWGG 1 cut(s) 112
MwoI GCNNNNNNNGC 1 cut(s) 33
NciI CCSGG 2 cut(s) 72, 73
NlaIV GGNNCC 1 cut(s) 77
PaeR7I CTCGAG 1 cut(s) 157
PceI AGGCCT 1 cut(s) 110
PkrI GCNGC 1 cut(s) 29
Psp6I CCWGG 1 cut(s) 110
PspGI CCWGG 1 cut(s) 110
PspN4I GGNNCC 1 cut(s) 77
PspPI GGNCC 2 cut(s) 57, 76
PspXI VCTCGAGB 1 cut(s) 157
SatI GCNGC 1 cut(s) 28
Sau96I GGNCC 2 cut(s) 57, 76
ScrFI CCNGG 3 cut(s) 72, 73, 112
SetI ASST 2 cut(s) 93, 164
SfaNI GCATC 2 cut(s) 143, 149
Sfr274I CTCGAG 1 cut(s) 157
SinI GGWCC 1 cut(s) 76
SlaI CTCGAG 1 cut(s) 157
SmaI CCCGGG 1 cut(s) 73
SmlI CTYRAG 2 cut(s) 104, 157
SmoI CTYRAG 2 cut(s) 104, 157
Sse9I AATT 1 cut(s) 37
SseBI AGGCCT 1 cut(s) 110
SsiI CCGC 2 cut(s) 30, 83
StuI AGGCCT 1 cut(s) 110
StyD4I CCNGG 3 cut(s) 70, 71, 110
TaqI TCGA 2 cut(s) 6, 158
TasI AATT 1 cut(s) 37
TscAI CASTG 1 cut(s) 129
TseI GCWGC 1 cut(s) 27
TspMI CCCGGG 1 cut(s) 71
TspRI CASTG 1 cut(s) 129
VpaK11BI GGWCC 1 cut(s) 76
XhoI CTCGAG 1 cut(s) 157
XmaI CCCGGG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.