Rmu_sc0040613.1_g000001

Indigoidine synthase A like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040613.1
Physical Location & Seq
Reverse (-)
1 .. 785
785 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040613.1_g000001.1.cds

Sequence Viewer

Length: 289 bp
atggcgtcgtcgtcgtcgtcttcagctctctcaagactgtccagtatcagcagacacttcaatccctcccacgcaaacaaggacggtgtggccttaatcaagatttctccagaggtttccgaagctttgtcaattgggcgtgccgtcgttgctcttgaatccaccattatttcccatgggatgccgtatcccaagaatttggagactgcaaaggaggttgaggcaattgtcagggaaaatggggctgttcctgccaccattgctatcttggatggcacaccttgcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

9.97

Weight (kDa)

6.26

Isoelectric Point (pI)

46.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 196
AcuI CTGAAG 1 cut(s) 6
AcyI GRCGYC 1 cut(s) 5
AgsI TTSAA 2 cut(s) 61, 158
AluBI AGCT 2 cut(s) 26, 125
AluI AGCT 2 cut(s) 26, 125
Alw26I GTCTC 1 cut(s) 197
AoxI GGCC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 196
BbsI GAAGAC 1 cut(s) 12
BccI CCATC 1 cut(s) 266
BceAI ACGGC 2 cut(s) 128, 169
BciVI GTATCC 1 cut(s) 198
BcoDI GTCTC 1 cut(s) 197
BfuI GTATCC 1 cut(s) 198
BmsI GCATC 1 cut(s) 171
BpiI GAAGAC 1 cut(s) 12
BpmI CTGGAG 1 cut(s) 93
BpuEI CTTGAG 1 cut(s) 16
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 175
Bse1I ACTGG 1 cut(s) 42
Bse3DI GCAATG 1 cut(s) 258
BseDI CCNNGG 1 cut(s) 175
BseGI GGATG 2 cut(s) 186, 277
BseMI GCAATG 1 cut(s) 258
BseNI ACTGG 1 cut(s) 42
BshFI GGCC 1 cut(s) 92
BsmAI GTCTC 1 cut(s) 197
BsnI GGCC 1 cut(s) 92
Bsp19I CCATGG 1 cut(s) 175
BspANI GGCC 1 cut(s) 92
BsrDI GCAATG 1 cut(s) 258
BsrI ACTGG 1 cut(s) 42
BssECI CCNNGG 1 cut(s) 175
BssNI GRCGYC 1 cut(s) 5
BssT1I CCWWGG 1 cut(s) 175
Bst4CI ACNGT 2 cut(s) 39, 86
BstACI GRCGYC 1 cut(s) 5
BstAPI GCANNNNNTGC 1 cut(s) 282
BstC8I GCNNGC 1 cut(s) 141
BstDSI CCRYGG 1 cut(s) 175
BstF5I GGATG 2 cut(s) 186, 277
BstMAI GTCTC 1 cut(s) 197
BstMWI GCNNNNNNNGC 4 cut(s) 149, 251, 260, 282
BstV2I GAAGAC 1 cut(s) 12
BstXI CCANNNNNNTGG 1 cut(s) 199
BsuI GTATCC 1 cut(s) 198
BsuRI GGCC 1 cut(s) 92
BtgI CCRYGG 1 cut(s) 175
BtsCI GGATG 2 cut(s) 186, 277
Cac8I GCNNGC 1 cut(s) 141
CviAII CATG 1 cut(s) 176
CviJI RGCY 4 cut(s) 26, 92, 125, 245
CviKI_1 RGCY 4 cut(s) 26, 92, 125, 245
Eco130I CCWWGG 1 cut(s) 175
Eco57I CTGAAG 1 cut(s) 6
EcoT14I CCWWGG 1 cut(s) 175
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 1 cut(s) 179
FaiI YATR 2 cut(s) 177, 287
FatI CATG 1 cut(s) 175
FokI GGATG 2 cut(s) 193, 284
GsuI CTGGAG 1 cut(s) 93
HaeIII GGCC 1 cut(s) 92
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 1 cut(s) 179
HindIII AAGCTT 1 cut(s) 123
HinfI GANTC 1 cut(s) 158
Hpy188I TCNGA 1 cut(s) 121
Hpy188III TCNNGA 4 cut(s) 33, 100, 110, 155
Hpy99I CGWCG 5 cut(s) 10, 13, 16, 19, 149
HpyCH4III ACNGT 2 cut(s) 39, 86
HpyCH4V TGCA 2 cut(s) 209, 285
HpyF10VI GCNNNNNNNGC 4 cut(s) 149, 251, 260, 282
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 1 cut(s) 179
LpnPI CCDG 4 cut(s) 55, 123, 217, 264
LweI GCATC 1 cut(s) 171
MboII GAAGA 1 cut(s) 12
MfeI CAATTG 2 cut(s) 132, 225
MluCI AATT 3 cut(s) 132, 196, 225
MnlI CCTC 4 cut(s) 76, 106, 208, 214
MseI TTAA 1 cut(s) 95
MunI CAATTG 2 cut(s) 132, 225
MwoI GCNNNNNNNGC 4 cut(s) 149, 251, 260, 282
NcoI CCATGG 1 cut(s) 175
NlaIII CATG 1 cut(s) 179
PcsI WCGNNNNNNNCGW 1 cut(s) 14
PfeI GAWTC 1 cut(s) 158
SaqAI TTAA 1 cut(s) 95
SetI ASST 5 cut(s) 28, 117, 127, 219, 283
SfaNI GCATC 1 cut(s) 171
SmlI CTYRAG 1 cut(s) 31
SmoI CTYRAG 1 cut(s) 31
Sse9I AATT 3 cut(s) 132, 196, 225
StyI CCWWGG 1 cut(s) 175
TaaI ACNGT 2 cut(s) 39, 86
TasI AATT 3 cut(s) 132, 196, 225
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
XapI RAATTY 1 cut(s) 196
XcmI CCANNNNNNNNNTGG 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.