Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000397.1

Orthogroup ID

OG0007924

Physical Location & Seq

Genomic Coordinates Reverse (-)

32249 .. 35085

Gene Structure 2837 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000397.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 588 bp

atggcgtcgtcgtcgtcgtcgtcttcagctctctcaagactgtccagtatcagcagacacttcaatccctcccacgcaaacaaggacggtgtggccttaatcaagatttctccagaggtttccgaagctttgtcaattgggcgtgccgtcgttgctcttgaatccaccattatttcccatgggatgccgtatcccaagaatttggagactgcaaaggaggttgaggcaattgtcagggaaaatggggctgttcctgccaccattgctatcttggatggcacaccttgcataggtctaactatagaagaactggagaggcttgccagattgggtccaagagctcagaagacagctcgaagagacattgcacatgttgtggcaaccagagggaacggtgcaactactgtttctgcaaccatgatttttgctcatatggttggcatcccattgtttgtaacgggaggaattggaggagtacatcaacatggcgagcatagtaagtcagttgtacattggcctatgaaatgtttctggcgtcctcttgaggccaatgagtttctggaatctgatgttggaagaggtggataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00240 map00240

Pfam Domains

Protein Families

Indigoidine_A

Protein Analysis

195

Amino Acids

20.67

Weight (kDa)

7.91

Isoelectric Point (pI)

31.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007924)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G50510
fragaria_vesca	FvH4_3g28170 FvH4_3g28170
malus_domestica	MD11G1196200.v1.1
prunus_persica	Prupe.4G258300_v2.0.a1 Prupe.4G258300_v2.0.a1 Prupe.4G258300_v2.0.a1
pyrus_communis	pycom11g16360
rosa_chinensis	RchiOBHm_Chr5g0050911
rosa_laevigata	RLG00000034743
rosa_multiflora	Rmu_sc0040613.1_g000001 Rmu_ssc0000397.1_g000002 Rmu_ssc0000397.1_g000006
rosa_roxburghii	Rroxscaffold_1G00029820 Rroxscaffold_3G00229240 Rroxscaffold_4G00318990 Rroxscaffold_4G00319000
rosa_rugosa	Rorug05G0265000.1 Rorug05G0265100.1
rosa_samantha	Rh5AG336900 Rh5BG346400 Rh5CG374100 Rh5DG359400
rosa_wichuraiana	Rw5G031760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	199
AcuI	CTGAAG	1 cut(s)	9
AcyI	GRCGYC	2 cut(s)	5, 535
AfaI	GTAC	2 cut(s)	477, 510
AfiI	CCNNNNNNNGG	1 cut(s)	290
AflIII	ACRYGT	1 cut(s)	370
AgsI	TTSAA	2 cut(s)	64, 161
AjuI	GAANNNNNNNTTGG	2 cut(s)	555, 587
AluBI	AGCT	4 cut(s)	29, 128, 341, 353
AluI	AGCT	4 cut(s)	29, 128, 341, 353
Alw21I	GWGCWC	1 cut(s)	343
Alw26I	GTCTC	2 cut(s)	200, 354
AoxI	GGCC	3 cut(s)	93, 515, 546
ApoI	RAATTY	1 cut(s)	199
Asp700I	GAANNNNTTC	1 cut(s)	527
AspS9I	GGNCC	1 cut(s)	332
AvaII	GGWCC	1 cut(s)	332
BanII	GRGCYC	1 cut(s)	343
BbsI	GAAGAC	2 cut(s)	15, 353
Bbv12I	GWGCWC	1 cut(s)	343
BccI	CCATC	1 cut(s)	269
BceAI	ACGGC	2 cut(s)	131, 172
BciVI	GTATCC	1 cut(s)	201
BcoDI	GTCTC	2 cut(s)	200, 354
BfmI	CTRYAG	1 cut(s)	300
BfuI	GTATCC	1 cut(s)	201
Bme18I	GGWCC	1 cut(s)	332
BmgT120I	GGNCC	1 cut(s)	332
BmiI	GGNNCC	1 cut(s)	333
BmsI	GCATC	2 cut(s)	174, 450
BpiI	GAAGAC	2 cut(s)	15, 353
BpmI	CTGGAG	2 cut(s)	96, 332
BpuEI	CTTGAG	2 cut(s)	19, 563
BsaHI	GRCGYC	2 cut(s)	5, 535
BsaJI	CCNNGG	1 cut(s)	178
Bsc4I	CCNNNNNNNGG	1 cut(s)	290
Bse1I	ACTGG	2 cut(s)	45, 315
Bse3DI	GCAATG	2 cut(s)	261, 363
BseDI	CCNNGG	1 cut(s)	178
BseGI	GGATG	3 cut(s)	189, 280, 441
BseLI	CCNNNNNNNGG	1 cut(s)	290
BseMI	GCAATG	2 cut(s)	261, 363
BseMII	CTCAG	1 cut(s)	356
BseNI	ACTGG	2 cut(s)	45, 315
BseRI	GAGGAG	1 cut(s)	486
BshFI	GGCC	3 cut(s)	95, 517, 548
BsiHKAI	GWGCWC	1 cut(s)	343
BslI	CCNNNNNNNGG	1 cut(s)	290
BsmAI	GTCTC	2 cut(s)	200, 354
BsnI	GGCC	3 cut(s)	95, 517, 548
Bsp1286I	GDGCHC	1 cut(s)	343
Bsp1407I	TGTACA	1 cut(s)	508
Bsp19I	CCATGG	1 cut(s)	178
BspANI	GGCC	3 cut(s)	95, 517, 548
BspCNI	CTCAG	1 cut(s)	355
BspLI	GGNNCC	1 cut(s)	333
BsrDI	GCAATG	2 cut(s)	261, 363
BsrGI	TGTACA	1 cut(s)	508
BsrI	ACTGG	2 cut(s)	45, 315
BssECI	CCNNGG	1 cut(s)	178
BssNI	GRCGYC	2 cut(s)	5, 535
BssT1I	CCWWGG	1 cut(s)	178
Bst4CI	ACNGT	4 cut(s)	42, 89, 395, 406
Bst6I	CTCTTC	2 cut(s)	352, 571
BstACI	GRCGYC	2 cut(s)	5, 535
BstAPI	GCANNNNNTGC	1 cut(s)	285
BstAUI	TGTACA	1 cut(s)	508
BstC8I	GCNNGC	3 cut(s)	144, 321, 491
BstDEI	CTNAG	1 cut(s)	342
BstDSI	CCRYGG	1 cut(s)	178
BstENI	CCTNNNNNAGG	1 cut(s)	288
BstF5I	GGATG	3 cut(s)	189, 280, 441
BstMAI	GTCTC	2 cut(s)	200, 354
BstMWI	GCNNNNNNNGC	4 cut(s)	152, 254, 263, 285
BstNSI	RCATGY	1 cut(s)	374
BstSFI	CTRYAG	1 cut(s)	300
BstV2I	GAAGAC	2 cut(s)	15, 353
BstXI	CCANNNNNNTGG	1 cut(s)	202
BsuI	GTATCC	1 cut(s)	201
BsuRI	GGCC	3 cut(s)	95, 517, 548
BtgI	CCRYGG	1 cut(s)	178
BtsCI	GGATG	3 cut(s)	189, 280, 441
Cac8I	GCNNGC	3 cut(s)	144, 321, 491
Cfr13I	GGNCC	1 cut(s)	332
CseI	GACGC	1 cut(s)	524
Csp6I	GTAC	2 cut(s)	476, 509
CviAII	CATG	4 cut(s)	179, 371, 418, 485
CviJI	RGCY	9 cut(s)	29, 95, 128, 248, 319, 341, 353, 517, 548
CviKI_1	RGCY	9 cut(s)	29, 95, 128, 248, 319, 341, 353, 517, 548
CviQI	GTAC	2 cut(s)	476, 509
DdeI	CTNAG	1 cut(s)	342
Eam1104I	CTCTTC	2 cut(s)	352, 571
EarI	CTCTTC	2 cut(s)	352, 571
Ecl136II	GAGCTC	1 cut(s)	341
Eco130I	CCWWGG	1 cut(s)	178
Eco24I	GRGCYC	1 cut(s)	343
Eco47I	GGWCC	1 cut(s)	332
Eco53kI	GAGCTC	1 cut(s)	341
Eco57I	CTGAAG	1 cut(s)	9
EcoICRI	GAGCTC	1 cut(s)	341
EcoNI	CCTNNNNNAGG	1 cut(s)	288
EcoT14I	CCWWGG	1 cut(s)	178
EcoT38I	GRGCYC	1 cut(s)	343
ErhI	CCWWGG	1 cut(s)	178
FaeI	CATG	4 cut(s)	182, 374, 421, 488
FatI	CATG	4 cut(s)	178, 370, 417, 484
FauNDI	CATATG	1 cut(s)	432
FokI	GGATG	3 cut(s)	196, 287, 428
FriOI	GRGCYC	1 cut(s)	343
GsuI	CTGGAG	2 cut(s)	96, 332
HaeIII	GGCC	3 cut(s)	95, 517, 548
HgaI	GACGC	1 cut(s)	524
Hin1I	GRCGYC	2 cut(s)	5, 535
Hin1II	CATG	4 cut(s)	182, 374, 421, 488
HindIII	AAGCTT	1 cut(s)	126
HinfI	GANTC	2 cut(s)	161, 563
Hpy188I	TCNGA	3 cut(s)	124, 345, 568
Hpy188III	TCNNGA	6 cut(s)	36, 103, 113, 158, 542, 560
Hpy99I	CGWCG	6 cut(s)	10, 13, 16, 19, 22, 152
HpyCH4III	ACNGT	4 cut(s)	42, 89, 395, 406
HpyCH4V	TGCA	5 cut(s)	212, 288, 368, 398, 413
HpyF10VI	GCNNNNNNNGC	4 cut(s)	152, 254, 263, 285
HpyF3I	CTNAG	1 cut(s)	342
Hsp92I	GRCGYC	2 cut(s)	5, 535
Hsp92II	CATG	4 cut(s)	182, 374, 421, 488
LpnPI	CCDG	9 cut(s)	58, 126, 220, 267, 296, 337, 397, 517, 545
LweI	GCATC	2 cut(s)	174, 450
MaeIII	GTNAC	1 cut(s)	454
MboII	GAAGA	5 cut(s)	15, 317, 358, 369, 588
MfeI	CAATTG	2 cut(s)	135, 228
MhlI	GDGCHC	1 cut(s)	343
MluCI	AATT	4 cut(s)	135, 199, 228, 465
MmeI	TCCRAC	1 cut(s)	553
MroXI	GAANNNNTTC	1 cut(s)	527
MseI	TTAA	1 cut(s)	98
MslI	CAYNNNNRTG	1 cut(s)	483
MunI	CAATTG	2 cut(s)	135, 228
MwoI	GCNNNNNNNGC	4 cut(s)	152, 254, 263, 285
NcoI	CCATGG	1 cut(s)	178
NdeI	CATATG	1 cut(s)	432
NlaIII	CATG	4 cut(s)	182, 374, 421, 488
NlaIV	GGNNCC	1 cut(s)	333
NspI	RCATGY	1 cut(s)	374
PciI	ACATGT	1 cut(s)	370
PcsI	WCGNNNNNNNCGW	2 cut(s)	14, 17
PdmI	GAANNNNTTC	1 cut(s)	527
PfeI	GAWTC	2 cut(s)	161, 563
PscI	ACATGT	1 cut(s)	370
Psp124BI	GAGCTC	1 cut(s)	343
PspN4I	GGNNCC	1 cut(s)	333
PspPI	GGNCC	1 cut(s)	332
RsaI	GTAC	2 cut(s)	477, 510
RsaNI	GTAC	2 cut(s)	476, 509
RseI	CAYNNNNRTG	1 cut(s)	483
SacI	GAGCTC	1 cut(s)	343
SaqAI	TTAA	1 cut(s)	98
Sau96I	GGNCC	1 cut(s)	332
SduI	GDGCHC	1 cut(s)	343
SetI	ASST	9 cut(s)	31, 120, 130, 222, 286, 295, 343, 355, 583
SfaNI	GCATC	2 cut(s)	174, 450
SfcI	CTRYAG	1 cut(s)	300
SinI	GGWCC	1 cut(s)	332
SmiMI	CAYNNNNRTG	1 cut(s)	483
SmlI	CTYRAG	2 cut(s)	34, 542
SmoI	CTYRAG	2 cut(s)	34, 542
Sse9I	AATT	4 cut(s)	135, 199, 228, 465
SstI	GAGCTC	1 cut(s)	343
StyI	CCWWGG	1 cut(s)	178
TaaI	ACNGT	4 cut(s)	42, 89, 395, 406
TaqI	TCGA	1 cut(s)	355
TasI	AATT	4 cut(s)	135, 199, 228, 465
TatI	WGTACW	2 cut(s)	475, 508
TfiI	GAWTC	2 cut(s)	161, 563
Tru1I	TTAA	1 cut(s)	98
Tru9I	TTAA	1 cut(s)	98
TspDTI	ATGAA	1 cut(s)	536
VpaK11BI	GGWCC	1 cut(s)	332
XagI	CCTNNNNNAGG	1 cut(s)	288
XapI	RAATTY	1 cut(s)	199
XceI	RCATGY	1 cut(s)	374
XcmI	CCANNNNNNNNNTGG	2 cut(s)	268, 556
XmnI	GAANNNNTTC	1 cut(s)	527

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.